View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3787_low_15 (Length: 241)
Name: NF3787_low_15
Description: NF3787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3787_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 8029613 - 8029505
Alignment:
| Q |
17 |
aattttgagctcacttttttgtacataaactttttatataatgttttaaatatgtatgaaaaatcattcaaaagttatgttaacttaacaacatagacta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
8029613 |
aattttgagctcacttttttgtacataaactttttatataatgttttaaatatgtttgaaaaatcattcaaaagttatgttaatttaacaacatagatta |
8029514 |
T |
 |
| Q |
117 |
aaattgttt |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
8029513 |
aaattgttt |
8029505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University