View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788-1-Insertion-14 (Length: 151)
Name: NF3788-1-Insertion-14
Description: FN3788-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788-1-Insertion-14 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 7e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 7e-32
Query Start/End: Original strand, 70 - 151
Target Start/End: Complemental strand, 42956095 - 42956014
Alignment:
| Q |
70 |
caggatcattaattgtgtttacaatttaccaagttagtttttgcttatgttttttataaaagctgttgcgataacatctttg |
151 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956095 |
caggatcactaattgtgtttacaatttaccaagttagattttgcctatgttttttataaaagctgttgcgataacatctttg |
42956014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 42956128 - 42956093
Alignment:
| Q |
8 |
tttaggctatcactatcttaattcattgtgtttcag |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956128 |
tttaggctatcactatcttaattcattgtgtttcag |
42956093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University