View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788-1-Insertion-17 (Length: 119)
Name: NF3788-1-Insertion-17
Description: FN3788-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788-1-Insertion-17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 88
Target Start/End: Complemental strand, 36195370 - 36195331
Alignment:
| Q |
49 |
aaaccaccatagcatcattctatcatcttaaaacctagtt |
88 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
36195370 |
aaaccactataacatcattctatcatcttaaaacctagtt |
36195331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University