View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788-2-Insertion-21 (Length: 304)
Name: NF3788-2-Insertion-21
Description: NF3788-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788-2-Insertion-21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 8 - 192
Target Start/End: Original strand, 6000261 - 6000445
Alignment:
| Q |
8 |
aaatggagatggatggtgttgctccgaggcgttggggtggtgctagagaacgccgtggtatattgtaatacaagttaattacttaacaagtgacacatat |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6000261 |
aaatggaggtggatggtgttgctccgaggcgtcggggtggtgctagagaatgccatggtatattgtaatacaagttaattacttaaaaagtgacacatat |
6000360 |
T |
|
| Q |
108 |
ctatagatctagaaatagatgagaataaattgaatgactgattttataaccatgtttagagatcagtcgtctatgtatgttttga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6000361 |
ctatagatctagaaatagatgagaataaattgagtgactgattttataaccatgtttagagatcagttgtctatgtatgttttga |
6000445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 191 - 304
Target Start/End: Original strand, 6000475 - 6000588
Alignment:
| Q |
191 |
gattacgcagtgatacttaattggtatgggagaattctttattctttctatacgtataacgatattgctatagaatctagtcttcaatgacacaaccttt |
290 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6000475 |
gattacgctgtgatacttaattggtatgggagaattcttttttctttctatacgaataacgatattgctatagaatctagtcttcaatgacacaaccttt |
6000574 |
T |
|
| Q |
291 |
gcgccaatttgtcg |
304 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6000575 |
gcgccaatttgtcg |
6000588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University