View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3788-Insertion-9 (Length: 109)

Name: NF3788-Insertion-9
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3788-Insertion-9
NF3788-Insertion-9
[»] chr6 (2 HSPs)
chr6 (8-66)||(33589155-33589213)
chr6 (8-60)||(33602280-33602332)


Alignment Details
Target: chr6 (Bit Score: 59; Significance: 2e-25; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 33589213 - 33589155
Alignment:
8 attttccccatgttcgcattctaactcctctataaagtgggtgattagggttatcactc 66  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33589213 attttccccatgttcgcattctaactcctctataaagtgggtgattagggttatcactc 33589155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 33602332 - 33602280
Alignment:
8 attttccccatgttcgcattctaactcctctataaagtgggtgattagggtta 60  Q
    |||||||||||||||||||||| || |||||||||| ||| || |||| ||||    
33602332 attttccccatgttcgcattcttacacctctataaactggatgcttagtgtta 33602280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University