View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788-Insertion-9 (Length: 109)
Name: NF3788-Insertion-9
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788-Insertion-9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 2e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 33589213 - 33589155
Alignment:
| Q |
8 |
attttccccatgttcgcattctaactcctctataaagtgggtgattagggttatcactc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33589213 |
attttccccatgttcgcattctaactcctctataaagtgggtgattagggttatcactc |
33589155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 33602332 - 33602280
Alignment:
| Q |
8 |
attttccccatgttcgcattctaactcctctataaagtgggtgattagggtta |
60 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| ||| || |||| |||| |
|
|
| T |
33602332 |
attttccccatgttcgcattcttacacctctataaactggatgcttagtgtta |
33602280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University