View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788_high_10 (Length: 405)
Name: NF3788_high_10
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 7e-93; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 158 - 384
Target Start/End: Complemental strand, 50409166 - 50408939
Alignment:
| Q |
158 |
atcatttatctcacttgtgttccatcaatatctttgatggagtatgtgggatttgagaaagnnnnnnnnnt-gtttttaatttgttagaataaaggatat |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
50409166 |
atcatttatctcacttgtgttccatccatatctttgatggaatatgtgggatttgagaaagaaaaaaaaattgtttttaatttgttagaataaaggatat |
50409067 |
T |
|
| Q |
257 |
tttggtaagttaatgatgctcatagggacatgagtgagatatttttccacaaacagagctttaaactcgttgccttcttgatattttacaattgcaaatt |
356 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50409066 |
tttggtaagttaatgatgttcatagggacatgagtgagatatttttccacaaacagagctttaaactcgttgtcttcttgatattttacaattgcaaatt |
50408967 |
T |
|
| Q |
357 |
gagtaattggtactctttcacatgagtg |
384 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
50408966 |
gagtaattggtactccttcacatgagtg |
50408939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 50409221 - 50409159
Alignment:
| Q |
49 |
gattttacaaatatcatttatcttttttaatccatccgatatgatttcataccaaatctttta |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
50409221 |
gatttcacaaatatcatttatcttttttaaatcatccgatatgatttcataccaaatcattta |
50409159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 129 - 168
Target Start/End: Complemental strand, 50409238 - 50409199
Alignment:
| Q |
129 |
catgagtatagagatacaatttcacaaatatcatttatct |
168 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50409238 |
catgagtatagagatacgatttcacaaatatcatttatct |
50409199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 44 - 76
Target Start/End: Complemental strand, 47113300 - 47113268
Alignment:
| Q |
44 |
aaaatgattttacaaatatcatttatctttttt |
76 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
47113300 |
aaaatgattgtacaaatatcatttatctttttt |
47113268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University