View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788_high_17 (Length: 320)
Name: NF3788_high_17
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 231
Target Start/End: Original strand, 45762232 - 45762452
Alignment:
| Q |
11 |
catagggagtcatgctcatggcttgtacctgcttttgtgtttgttaatattgttgttttcattgtggtcatgggcatcaacaattgtcctaacaccactt |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45762232 |
catagagagtcatgctcatggcttgtacctgcttttgtgtttgttaatattgttgttttcattgtggtcatgggcatcaacaattgtcctaacaccactt |
45762331 |
T |
 |
| Q |
111 |
ttggttttcataaacatcatcatcattgtgttgctaggtttcttcacaggttctcttttcagccttttagggagaatccattgcttggtccttcttcctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45762332 |
ttggttttcataaacatcatcatcattgtgttgctaggtttcttcacaggttctcttttcagccttttagggagaatccattgcttggtccttcttcctt |
45762431 |
T |
 |
| Q |
211 |
aacgtaagagattcaaatcaa |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45762432 |
aacgtaagagattcaaatcaa |
45762452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 39279296 - 39279342
Alignment:
| Q |
161 |
ttctcttttcagccttttagggagaatccattgcttggtccttcttc |
207 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
39279296 |
ttctcttttcagcctttgaaagagaatcctttgcttggtccttcttc |
39279342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University