View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788_high_20 (Length: 300)
Name: NF3788_high_20
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 40903553 - 40903824
Alignment:
| Q |
19 |
ctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcgccaccgcaggccggtgaagtccgtctcaagatactcttcacctc |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903553 |
ctgcggttgcatgggaagcggggaagccgctggtgatggaagaagtagaggtggctccaccgcaggccggtgaagtccgtctcaagatactcttcacctc |
40903652 |
T |
 |
| Q |
119 |
cctttgtcacactgatgtttacttctgggaagctaaggtannnnnnngattacataacacggcgggtgcttagttttcttacacaaaagttaatttacgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40903653 |
cctttgtcacactgatgtttacttctgggaagctaaggtatttttttgattacataacacggcgggtgcttagttttcttacacaaaagttaatttatgt |
40903752 |
T |
 |
| Q |
219 |
aaaattcttcttaggttttcatgttttgttttgcattgcagtgatttaatatggttttcttgttttcctttg |
290 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40903753 |
aaaattcttcttaggttttcatgttctgttttgcattgcagtgatttaatatggttttcttgttttcctttg |
40903824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 40898877 - 40899016
Alignment:
| Q |
19 |
ctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcgccaccgcaggccggtgaagtccgtctcaagatactcttcacctc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40898877 |
ctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcaccaccgcaggccggtgaagtccgtctcaagatactcttcacctc |
40898976 |
T |
 |
| Q |
119 |
cctttgtcacactgatgtttacttctgggaagctaaggta |
158 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40898977 |
cctttgtcacaccgatgtttacttctgggaagctaaggta |
40899016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 40879952 - 40880091
Alignment:
| Q |
19 |
ctgcggttgcatgggaggcggggaagccactggtgatggaagaagtagaggtggcgccaccgcaggccggtgaagtccgtctcaagatactcttcacctc |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879952 |
ctgcggttgcatgggaggcagggaagccactggtgatggaggaagtggaggtggcgccaccgcaggccggtgaagtccgtctcaagatactcttcacctc |
40880051 |
T |
 |
| Q |
119 |
cctttgtcacactgatgtttacttctgggaagctaaggta |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40880052 |
tctttgtcacactgatgtttacttctgggaagctaaggta |
40880091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 277
Target Start/End: Original strand, 40899248 - 40899294
Alignment:
| Q |
231 |
aggttttcatgttttgttttgcattgcagtgatttaatatggttttc |
277 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
40899248 |
aggttttgatgttctgttgtgcattgcagtgatttaatatggttttc |
40899294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 229
Target Start/End: Original strand, 40899125 - 40899188
Alignment:
| Q |
166 |
gattacataacacggcggg-tgcttagttttcttacacaaaagttaatttacgtaaaattcttct |
229 |
Q |
| |
|
|||||||||||||| ||| |||||||||| || ||| ||||||||||||| ||||||||||||| |
|
|
| T |
40899125 |
gattacataacacgttggggtgcttagttt-ctaacaaaaaagttaatttatgtaaaattcttct |
40899188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University