View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788_high_23 (Length: 244)
Name: NF3788_high_23
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 3664524 - 3664317
Alignment:
| Q |
1 |
aagtttctcattcacaatttcattttctaacactctaacattcttttctaacatttattattttattaattacaactttcttaggaaccatgtgtgtcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3664524 |
aagtttctcattcacaatttcattttctaacactctaacattcttttctaacatttattattttattaattacaactttcttaggaaccatgtgtgtcga |
3664425 |
T |
 |
| Q |
101 |
ccaaatcatgagaattaagaaggtaccnnnnnnnaaaaattgatttccaaactttctattgatggcattatgtcatatgatgtttagttagttattttca |
200 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3664424 |
ccaaataatgagaattaagaaggcaccttttttt-aaaattgatttccagac-ttctattgatggcattatgtcatatgatgtttagttagttattttca |
3664327 |
T |
 |
| Q |
201 |
tgttatttag |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
3664326 |
tgttatttag |
3664317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University