View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788_high_9 (Length: 409)
Name: NF3788_high_9
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788_high_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 112 - 409
Target Start/End: Complemental strand, 50409866 - 50409569
Alignment:
| Q |
112 |
cctaacatttctagcgagatcaacaaatgaaggaatagagagaatgtaccgtcgctgaaatcgctgaactcgctgtcatcgctatcgacgtcagcggctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50409866 |
cctaacatttctagcgagatcaacaaatgaaggaatagagagaatgtaccgtcgctgaaatcgctgaactcgctgtcatcgctatcgacgtcagcggctt |
50409767 |
T |
 |
| Q |
212 |
cgtcttcgaagaactgaacgactcctcgattcttccgtttgccggtcttgtcgtcatcgaagttgttcttccgtttgccggaggaaccttttccggcggg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50409766 |
cgtcttcgaagaactgaacgactcctcgattcttccgtttgccggtcttgtcgtcatcgaagttgttcttccgtttgccggaggaaccttttccggcggg |
50409667 |
T |
 |
| Q |
312 |
agctttacccttgaaggcgggagctttgcccttgttcgtcatttccggtgaattgaaaccaatgcgaattgcatgcacagagagaaaaaggaggtgaa |
409 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50409666 |
agctttacccttgacggcgggagctttgcccttgttcgtcatttccggtgaattgaaaccaatgcgaattgcatgcacagagagaaaaaggaggtgaa |
50409569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University