View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788_low_15 (Length: 331)
Name: NF3788_low_15
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 246 - 330
Target Start/End: Complemental strand, 6859741 - 6859657
Alignment:
| Q |
246 |
cagctttagagagtgcattttggtgaacacaccatattcctactacattttgcttcggactctaatgcattctgagttgtgtcct |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6859741 |
cagctttagagagtgcattttggtgaacacaccatattcctactacattttgcttcggactctaatgcattctgagttgtgtcct |
6859657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 6859844 - 6859751
Alignment:
| Q |
1 |
taattacacatattgatatacatgtgtaagtagtagctcatacatatcaatnnnnnnnnnttaagctttgatttttcttttatgggaaattagtc |
95 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6859844 |
taattatacatattgatatacatgtgtaagtagtagcccatacatatcaat-aaaaaaaattaagctttgatttttcttttatgggaaattagtc |
6859751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University