View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3788_low_19 (Length: 305)
Name: NF3788_low_19
Description: NF3788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3788_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 33144738 - 33144473
Alignment:
| Q |
19 |
gttttctggctaatttctcgaatgagctaactgtgttttccaaagatggagtatgttgatattgttgggtttaacaagtgattctttgacacgatccagt |
118 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||| |||||||| | ||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
33144738 |
gttttcgggctaatttctcgaaggagctaactgtgttttccacagatggaggag-----tattgttgggtttgacaagtgattctttgacacgatcaagt |
33144644 |
T |
|
| Q |
119 |
tctgctttgaagtctaatgaaattttttcatgttctctagtctcttcctccaaatcgctaattgtgttttccatagatggcattttgctcatcatgttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33144643 |
tctgctttgaagtctaatgaaattttttcatgttctctagtctcttcctccaaatcgcgaattgtgttttccatagatggcattttgctcatcatattga |
33144544 |
T |
|
| Q |
219 |
gttcaacaaataactctttgaaacgatccactttcgctctcaactccatcgacagttttccatcttctctg |
289 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33144543 |
gttcagcaaataactctttgaaacgatccactttcgctctcaactccatcgacagttttccatcttctctg |
33144473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University