View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3790_low_3 (Length: 261)
Name: NF3790_low_3
Description: NF3790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3790_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 241
Target Start/End: Complemental strand, 49903584 - 49903353
Alignment:
| Q |
10 |
ataatacttctccaaattaaaatacaaaatcttaaattcctgtttccttcnnnnnnntcttagattcttgcaaatgccccttcaataatcaaatagattg |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49903584 |
ataacacttctccaaattaaaatacaaaatcttaaattcctgtttccttcaaaaaaatcttagattcttgcaaatgccccttcaataatcaaatagattg |
49903485 |
T |
|
| Q |
110 |
gtccttgtaacaaaactatttttcttgtgctatattatttcaatttttcttgcccgatgatactccctgaactcactagat-aaacaaaaacatgatagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
49903484 |
gtccttgtaacaaaactatttttcttgtgctatattatttcaatttttcttgcccgatgata-tccccgaactcactagataaaacaaaaacatgatagt |
49903386 |
T |
|
| Q |
209 |
tcttgcaataggacggaaattcaaggtaacccg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49903385 |
tcttgcaataggacggaaattcaaggtaacccg |
49903353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 240
Target Start/End: Original strand, 49024004 - 49024056
Alignment:
| Q |
188 |
gataaacaaaaacatgatagttcttgcaataggacggaaattcaaggtaaccc |
240 |
Q |
| |
|
||||||||||| || ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
49024004 |
gataaacaaaaccaagatagtttctgcattaggacggaaattcaaggtaaccc |
49024056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University