View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3791_high_4 (Length: 320)
Name: NF3791_high_4
Description: NF3791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3791_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 83 - 304
Target Start/End: Original strand, 38345830 - 38346051
Alignment:
| Q |
83 |
cctttcaaggaatgtaattggtcttttattcgttacttacattttcattattgttggaattggacctgtagatgtatcattcaacattgatgcaacacat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38345830 |
cctttcaaggaatgtaattggtcttttattcgttacttacattttcgttattgttggaattggacctgtagatgtatcattcaacattgatgcaacacat |
38345929 |
T |
 |
| Q |
183 |
ggtattattcgaatttctggtgcaatagatccaatcaagcttttgacggaaataaagaaagctgggaaacacgctgaacttattgctgccgatatcagcg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38345930 |
ggtattattcgaatttctggtgcaatagatccaatcaagcttctgactgaaataaagaaagctgggaaacacgctgaacttattgctgccgatatcagcg |
38346029 |
T |
 |
| Q |
283 |
gcaacaacaatggtggcagtgt |
304 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38346030 |
gcaacaacaatggtggcagtgt |
38346051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 115 - 271
Target Start/End: Complemental strand, 45043871 - 45043713
Alignment:
| Q |
115 |
ttacttacattttcat--tattgttggaattggacctgtagatgtatcattcaacattgatgcaacacatggtattattcgaatttctggtgcaatagat |
212 |
Q |
| |
|
||||||||||||| || |||| |||||||||| ||||||||| || || | || ||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
45043871 |
ttacttacattttaatcatattattggaattggctttgtagatgtttcctttactatcgatgcaacacacggtattattcgaatttctggagcaatagat |
45043772 |
T |
 |
| Q |
213 |
ccaatcaagcttttgacggaaataaagaaagctgggaaacacgctgaacttattgctgc |
271 |
Q |
| |
|
|||| ||||||||||| ||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
45043771 |
ccaagtaagcttttgaccgaaataacaaaagctgggaaacatgctgaactcattgctgc |
45043713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 45047513 - 45047475
Alignment:
| Q |
240 |
aaagctgggaaacacgctgaacttattgctgccgatatc |
278 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45047513 |
aaagctgggaaacacgctgaactccttgctgccgatatc |
45047475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 253
Target Start/End: Complemental strand, 45040102 - 45040033
Alignment:
| Q |
184 |
gtattattcgaatttctggtgcaatagatccaatcaagcttttgacggaaataaagaaagctgggaaaca |
253 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||| ||||| ||||| ||||||| |||||||| ||||| |
|
|
| T |
45040102 |
gtatcattcgaatttctggggcaattgatccaaataagctcttgactgaaataacaaaagctggaaaaca |
45040033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University