View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3791_low_7 (Length: 250)
Name: NF3791_low_7
Description: NF3791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3791_low_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 51 - 250
Target Start/End: Complemental strand, 22775943 - 22775737
Alignment:
| Q |
51 |
tgctactaaataatggagattaataccgtttcaca----tacctttctgatcgattcagtgttgtatttcaattgcttcaatcaaccaatttatttctta |
146 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| || |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
22775943 |
tgctactaaacaatggagattaatgtcgtttcacaaatatatctttctgatcgattcagtgttgaatttcaattgtttcaatcaaccaatttatttctta |
22775844 |
T |
 |
| Q |
147 |
aaattttattgttgttatctatttcaacctttccgatca---attgttgatctatttcaatttttccaaacatgtaccatacacaaccaattcattcgtt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
22775843 |
aaattttattgttgttatctatttcaacctttccgatcaattattgttaatctatttcaatctttccaaatatgtaccacactcaaccaattcattcgtt |
22775744 |
T |
 |
| Q |
244 |
cctaatc |
250 |
Q |
| |
|
| ||||| |
|
|
| T |
22775743 |
cttaatc |
22775737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University