View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3791_low_8 (Length: 250)
Name: NF3791_low_8
Description: NF3791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3791_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 38345243 - 38345072
Alignment:
| Q |
1 |
tacaaaactataaacagtacttttggaaggaaaaaataactaagatacataaattaaaacatcnnnnnnntgattacttgcttaattttttctttaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||| ||||||| |
|
|
| T |
38345243 |
tacaaaactataaacagtacttttggaaggaaaaaataactaagatacataaattaaaacataaaaaaaatgtttacttccttaattttttccttaaaca |
38345144 |
T |
 |
| Q |
101 |
aacacattcttatgagttaaaatttccaacatgtattttacatatacatacagatcaggatgaaactcataa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
38345143 |
aacacattcttatgagttaaaatttccaacatgtcttttacatatacatacagattaggatcaaactcataa |
38345072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University