View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3791_low_9 (Length: 248)
Name: NF3791_low_9
Description: NF3791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3791_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 48674477 - 48674236
Alignment:
| Q |
1 |
tttcatgttttcttctctttttgtgtaaaggttgagtgcgaaaaatgtaagtatattggagaacttaagcatcatctttg------------gtaacaaa |
88 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
48674477 |
tttcatattttcttctctttttgtgtaaaggttgagtgcgaaaaatgtaagtatattggagaacttaagcatgatctttgtcaacatacatggtaacaaa |
48674378 |
T |
|
| Q |
89 |
tctcagcattttctcttttctttgtggcatgtaatcttcttcagccattttttcatcaacagtacaactcactaaaagctgttgaatttaagagagagat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
48674377 |
tctcagcattttctcttttctttgtggcatgtaatcttcttcagccattttttcatcaacagt---gttcactaaaagctgttgaa-ttaagagagagat |
48674282 |
T |
|
| Q |
189 |
aatgaattttctctttcttaatgcaatgcttctacaacgacacagg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674281 |
aatgaattttctctttcttaatgcaatgcttctacaacgacacagg |
48674236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University