View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3792_low_11 (Length: 304)
Name: NF3792_low_11
Description: NF3792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3792_low_11 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 14 - 304
Target Start/End: Original strand, 3744073 - 3744363
Alignment:
| Q |
14 |
cagagaagatttttggaatatggaacagagaagctttgcacaagagaaagcatatggcatagatagaaacagtgacacatcattcgggataaaacgctat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744073 |
cagagaagatttttggaatatggaacagagaagctttgcacaagagaaagcatatggcatagattgaaacagtgacacatcattcgggataaaacgctat |
3744172 |
T |
 |
| Q |
114 |
gtttagcattattgaaacatagcaaaaacgttttatcccgtagcatcccaaatgatgtatcactgtccctatatctatgtcatgtgctttctcttgtgca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| | |
|
|
| T |
3744173 |
gtttagcattattgaaacatagcaaaaacgttttatcccgtagcatcccaaatgatgtatcactgttcctatatctatgccatgtgctttctcttgtgta |
3744272 |
T |
 |
| Q |
214 |
aagcttagtcttcaaactcagtaaaattttgaaatatatataattttataaatttatttgatagtcctgagatggttgaacaatgaattat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744273 |
aagcttagtcttcaaactcagtaaaattttgaaatatctataatttcataaatttatttgatagtcctgagatggttgaacaatgaattat |
3744363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 103
Target Start/End: Complemental strand, 3744278 - 3744217
Alignment:
| Q |
44 |
aagctttgcacaagagaaagcatatggcatag--atagaaacagtgacacatcattcgggat |
103 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| |||| |||||||| |||||||| ||||| |
|
|
| T |
3744278 |
aagctttacacaagagaaagcacatggcatagatataggaacagtgatacatcatttgggat |
3744217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 36 - 79
Target Start/End: Original strand, 20196243 - 20196286
Alignment:
| Q |
36 |
gaacagagaagctttgcacaagagaaagcatatggcatagatag |
79 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
20196243 |
gaacaaagaagttttgcacaagagaaagcatgtggcatagatag |
20196286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University