View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3792_low_21 (Length: 235)
Name: NF3792_low_21
Description: NF3792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3792_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 29471019 - 29470877
Alignment:
| Q |
1 |
catccgataaaaattaatggttgagatcatttaaaactaacttaacaattttgaaattagagttgtctaatctgaaatcaatgaccaaaattcgtcgtgt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
29471019 |
catcccataaaaattaatggttgagatcatttaaaactaacttaacaattttgaaattagagttgtctaatatgaaatcaatgaccaagattcgtcgtgt |
29470920 |
T |
|
| Q |
101 |
gtaaccacatggaatttctaacgtagataatccaaatccatat |
143 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
29470919 |
gtaatcacatggaacttctaacgcagataatccaagtccatat |
29470877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 199
Target Start/End: Complemental strand, 29470671 - 29470600
Alignment:
| Q |
128 |
taatccaaatccatattataaatactaagtatgtacacatctctttgcatgagaacttcataatcaatttta |
199 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29470671 |
taatccaagtccatattataaatactatgtatgtacacatctctttgcatgagaacttcataatcaagttta |
29470600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University