View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3792_low_25 (Length: 207)
Name: NF3792_low_25
Description: NF3792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3792_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 109 - 191
Target Start/End: Original strand, 1178967 - 1179049
Alignment:
| Q |
109 |
ttttgagctacattttaagttacttttcagttacatccatcgttagttcaagatctagaattattatcacctatgtggtagat |
191 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178967 |
ttttgagttacattttaagttacttttcagttacatccatcgttagttcaagatctagaattattatcacctatgtggtagat |
1179049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 61 - 122
Target Start/End: Original strand, 1178836 - 1178897
Alignment:
| Q |
61 |
tcatggtttctaagattgtttaagttgcattctatgccgctgtctaaattttgagctacatt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1178836 |
tcatggtttctaagattgtttaagttgcattctatgccgctgtctaaattttgagttacatt |
1178897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 156
Target Start/End: Complemental strand, 43169735 - 43169688
Alignment:
| Q |
109 |
ttttgagctacattttaagttacttttcagttacatccatcgttagtt |
156 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
43169735 |
ttttgagttacattttaagttgcttttcagttacatctatcgttagtt |
43169688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 115
Target Start/End: Original strand, 37500177 - 37500229
Alignment:
| Q |
63 |
atggtttctaagattgtttaagttgcattctatgccgctgtctaaattttgag |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
37500177 |
atggtttctaagtttgtttaagttgcattgcatgatgctgtctaaattttgag |
37500229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University