View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3793_high_20 (Length: 227)
Name: NF3793_high_20
Description: NF3793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3793_high_20 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 4382926 - 4382696
Alignment:
| Q |
14 |
ttctccattcatatcatccattgtaaattcaattgtatccatatacaacttttcttcatcaccttcttcccagccgcagcacgtgatcttcacctt---- |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4382926 |
ttctccattcatatcatccattgtaaattcaattgtatccatatagaacttctcttcatcaccttcttcccagccgcagcacgtgatcttcacctcacac |
4382827 |
T |
 |
| Q |
110 |
-------------tataaaaccctacaggcgccggtatgaaggtctcaaacaccacttcaacttcaacacttatgggcaagcgtattctcgtctctttca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4382826 |
ttgaccatctctgtataaaaccctacaggcgccggtatgaaggtctcaaacaccacttcaacttcaacacttatgggcaagcgtattctcgtctctttca |
4382727 |
T |
 |
| Q |
197 |
cccaaacgggtttacaagtagaaggatgaaa |
227 |
Q |
| |
|
|| |||| ||||||||||||||||||||||| |
|
|
| T |
4382726 |
ccgaaacaggtttacaagtagaaggatgaaa |
4382696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 227
Target Start/End: Original strand, 4112546 - 4112585
Alignment:
| Q |
188 |
tctctttcacccaaacgggtttacaagtagaaggatgaaa |
227 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
4112546 |
tctctttcaccgaaacaggtttacaagtagaaggatgaaa |
4112585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University