View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3793_high_22 (Length: 204)

Name: NF3793_high_22
Description: NF3793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3793_high_22
NF3793_high_22
[»] chr7 (2 HSPs)
chr7 (45-119)||(20477401-20477475)
chr7 (152-186)||(20477490-20477524)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 45 - 119
Target Start/End: Original strand, 20477401 - 20477475
Alignment:
45 tcagggatgaacaaacttggtgaatttttggacgtcaatcgtaaagtagggttccagaattgaacccaacattct 119  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||| |||||    
20477401 tcagggatgatcaaacttggtgaatttttggacgtcaatcgtaaagtagggttccagaataaaacccaaaattct 20477475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 186
Target Start/End: Original strand, 20477490 - 20477524
Alignment:
152 aatcatacaaaccaggccgttggcagagccaattg 186  Q
    |||||||||||||||||||||||||||||||||||    
20477490 aatcatacaaaccaggccgttggcagagccaattg 20477524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University