View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3794_high_15 (Length: 268)
Name: NF3794_high_15
Description: NF3794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3794_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 44 - 219
Target Start/End: Complemental strand, 2223882 - 2223714
Alignment:
| Q |
44 |
atgcatgtatatcattattttattataagtacgtacgtacctattgatctggaagttgcgagtactcctaaaacacgattcccattccaatcaatcactc |
143 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223882 |
atgcatgtatatcatt---ttattataagtacgtac----ctattgatctggaagttgcgagtactcctaaaacacgattcccattccaatcaatcactc |
2223790 |
T |
 |
| Q |
144 |
ttccacctgctgcttcaatcctttctctttcatccggaagatctggctgatcgatcatcattaaataataataatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223789 |
ttccacctgctgcttcaatcctttctctttcatccggaagatctggctgatcgatcatcattaaataataataatt |
2223714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University