View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3794_high_17 (Length: 254)
Name: NF3794_high_17
Description: NF3794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3794_high_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 6612043 - 6611790
Alignment:
| Q |
1 |
tacaatgaagaatgtgaccgattcatggtaggaatttgatttatttcttcatgcccaccacagtccttccatggttttgtaaatcttatattttcctact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6612043 |
tacaatgaagaatgtgaccgattcatggtaggaatttgatttatttcttcatgcccaccacagtccttccatggttttgtaaatcttatattttcctact |
6611944 |
T |
 |
| Q |
101 |
ataaatttgcagatatgcatggttcacaaacttggctatgggaactgggatgagttgaaggcagcgtttcgaacatcacccttgtttagatttgattggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6611943 |
ataaatttgcagatatgcatggttcacaaacttggctatgggaactgggatgagttgaaggcagcgtttcgaacatcacccttgtttagatttgattggt |
6611844 |
T |
 |
| Q |
201 |
ttgttaagtctcgcacaacacaggaacttgcaaggaggtgcgacaccctcattc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6611843 |
ttgttaagtctcgcacaacacaggaacttgcaaggaggtgcgacaccctcattc |
6611790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 111 - 254
Target Start/End: Original strand, 49259335 - 49259478
Alignment:
| Q |
111 |
agatatgcatggttcacaaacttggctatgggaactgggatgagttgaaggcagcgtttcgaacatcacccttgtttagatttgattggtttgttaagtc |
210 |
Q |
| |
|
||||||||||| |||||| ||||||||||| || |||||||| ||||| || || ||||||| |||||||||||| | |||||||||||||| ||||| |
|
|
| T |
49259335 |
agatatgcatgactcacaagcttggctatggtaattgggatgaattgaaagctgcatttcgaatgtcacccttgtttcgttttgattggtttgtaaagtc |
49259434 |
T |
 |
| Q |
211 |
tcgcacaacacaggaacttgcaaggaggtgcgacaccctcattc |
254 |
Q |
| |
|
|||||||| |||||| | ||||||| || ||||||||||||| |
|
|
| T |
49259435 |
acgcacaactcaggaattaacaaggagatgtgacaccctcattc |
49259478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University