View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3794_high_22 (Length: 248)
Name: NF3794_high_22
Description: NF3794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3794_high_22 |
 |  |
|
| [»] scaffold0182 (1 HSPs) |
 |  |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 18244404 - 18244543
Alignment:
| Q |
1 |
ttatatttacattagtgatgatttcaaagacctaatattgtggccgccatcgcaatttaaaactg-aaaaaatatttttaacttgattcccctatagaaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18244404 |
ttatatttacattagtgatgatttcaaagacctaatattgtggccgccatcgcaatttaaaactgaaaaaaatatttttaacttgattcccctatagaaa |
18244503 |
T |
 |
| Q |
100 |
atagaaaaatgataggagtatgttgaatcaactaggtttt |
139 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18244504 |
atagaaaaatgataggaatatgttgaatcaactaggtttt |
18244543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 118 - 232
Target Start/End: Original strand, 18244543 - 18244650
Alignment:
| Q |
118 |
tatgttgaatcaactaggttttcgtctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtct |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||| |||||| |||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
18244543 |
tatgttgaatcaactaggttttcgtttacccaagagcatttagattaaatgacacttgtctcttctaacttaaccaa-------ggtttgaattcagtct |
18244635 |
T |
 |
| Q |
218 |
tggacatgcagcagc |
232 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
18244636 |
tgaacatgcagcagc |
18244650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 145 - 231
Target Start/End: Original strand, 10591906 - 10591992
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
|||||||||| ||||||| ||||| | |||||||||||| |||||||||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
10591906 |
acccaagagcacttagatgagatggaacgggtctcttctagattaaccaaggtcctgggttcgaatccagccttgggcatgcagcag |
10591992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 145 - 218
Target Start/End: Original strand, 3741106 - 3741179
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtctt |
218 |
Q |
| |
|
||||||||||| |||||| ||||| | | ||||||||||||||||||| |||| || |||||||||||||||| |
|
|
| T |
3741106 |
acccaagagcgtttagatgagatgtcgtgtgtctcttctagcttaaccatggtcgtgagtttgaattcagtctt |
3741179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 232
Target Start/End: Complemental strand, 2804643 - 2804557
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||| |||||| |||||| | |||| |||||||||||||||||||| ||||||| |||| || |||| ||||||||||| |
|
|
| T |
2804643 |
acccaagagcagttagatgagatgaaa-cggtttcttctagcttaaccaaggttttgggttcgaatccaaccttgagcatgcagcagc |
2804557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 230
Target Start/End: Complemental strand, 30785118 - 30785063
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||| ||| |||||||||||||| |
|
|
| T |
30785118 |
gtctcttctagcttaatcaatgtcttgggttcgaatccagctttggacatgcagca |
30785063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 22188127 - 22188083
Alignment:
| Q |
176 |
tctcttctagcttaaccaaggtcttgggtttgaattcagtcttgg |
220 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
22188127 |
tctcttctaacttaaccaaggtattgggtttgaatccagccttgg |
22188083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 194
Target Start/End: Complemental strand, 28023608 - 28023556
Alignment:
| Q |
142 |
tctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaa |
194 |
Q |
| |
|
||||||||||||||||||||| ||||| | | ||||||||||||||||||| |
|
|
| T |
28023608 |
tctacccaagagcgcttagatgagatggaacggatctcttctagcttaaccaa |
28023556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 145 - 232
Target Start/End: Complemental strand, 8839443 - 8839356
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||||| |||||| | ||||||||||||||||||||||||| |||||| |||| ||| ||||| ||||||||||| |
|
|
| T |
8839443 |
acccaagagcgcttagatgagatgaaacgggtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcagc |
8839356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 145 - 231
Target Start/End: Original strand, 29059784 - 29059870
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
|||||||||| ||||||| ||||| | ||||||||||||||||||||||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
29059784 |
acccaagagcacttagatgagatggaacgggtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcag |
29059870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 144 - 232
Target Start/End: Complemental strand, 13254264 - 13254176
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||||||||||||||||||||| || ||| |||| ||| ||| | ||||||||||| |
|
|
| T |
13254264 |
tacccaagagcgcttagatgagatggaacgggtctcttctagcttaaccaaggtcctgagttcgaatccagccttaggcatgcagcagc |
13254176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 144 - 227
Target Start/End: Complemental strand, 19477412 - 19477329
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||||| |||||| ||||| | |||||||||||||||||||||||| ||||||||||| ||| ||||| |||||| |
|
|
| T |
19477412 |
tacccaagagcgtttagatgagatggaacgggtctcttctagcttaaccaaggttctgggtttgaatccagccttgggcatgca |
19477329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 229
Target Start/End: Complemental strand, 7265476 - 7265391
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagc |
229 |
Q |
| |
|
|||||||||||| ||| || |||||||| ||||||||||||||||||||| || ||||||| | || |||||||| |||||||| |
|
|
| T |
7265476 |
tacccaagagcgtttatatgagatgacacgggtctcttctagcttaaccaaagttttgggttcggatctagtcttgggcatgcagc |
7265391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 31492111 - 31492168
Alignment:
| Q |
174 |
ggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
31492111 |
ggtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcag |
31492168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 28537368 - 28537451
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||||||| ||||| |||||| ||||||| |||| ||| ||||| |||||| |
|
|
| T |
28537368 |
tacccaagagcgcttagatgagatggaacgggtctcttctaacttaatcaaggttttgggttcgaatccagccttgggcatgca |
28537451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 46373652 - 46373727
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttgg |
220 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||||||||||||| |||| || |||||| |||| ||||||||| |
|
|
| T |
46373652 |
acccaagagctcttagatgagatgacgcgggtctcttctagcttaagcaagatcctgggttcgaatccagtcttgg |
46373727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 232
Target Start/End: Complemental strand, 27484199 - 27484124
Alignment:
| Q |
157 |
ttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| || |||| ||| ||| | ||| ||||||||||| |
|
|
| T |
27484199 |
ttagatgagatgacacaagtctcttctagcttaaccaaggtcctgagtttaaatccagccatgggcatgcagcagc |
27484124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 197
Target Start/End: Original strand, 5546679 - 5546729
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggt |
197 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||||||||| |||||| |
|
|
| T |
5546679 |
ccaagagcgcttaaatgagatgacataagtctcttctagcttaatcaaggt |
5546729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 229
Target Start/End: Complemental strand, 7190519 - 7190437
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagc |
229 |
Q |
| |
|
||||||||| |||||| ||||| || |||||||||||||||||||||| || |||||||||||| |||| |||||||| |
|
|
| T |
7190519 |
ccaagagcgtttagatgagatggaataaatctcttctagcttaaccaaggttatgagtttgaattcagcattgggcatgcagc |
7190437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 210
Target Start/End: Complemental strand, 46567721 - 46567655
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaat |
210 |
Q |
| |
|
||||||| | || |||||| ||||||||| ||||| || || ||||| ||||||||||||||||||| |
|
|
| T |
46567721 |
tacccaaaaacgattagatgagatgacataggtcttttttaacttaatcaaggtcttgggtttgaat |
46567655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 38305035 - 38304970
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaat |
210 |
Q |
| |
|
||||| ||||| |||||||||||| | | | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38305035 |
acccacgagcgtttagattagatgtcgtggatctcttctaacttaaccaaggttctgggtttgaat |
38304970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 14)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 143 - 232
Target Start/End: Complemental strand, 36994664 - 36994575
Alignment:
| Q |
143 |
ctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||||| |||||||||||| |||||| |||| ||| ||||||||||||||||| |
|
|
| T |
36994664 |
ctacccaagagcgcttagataagatggcacatgtctcttctagtttaaccaaggtcctgggttcgaatccagccttggacatgcagcagc |
36994575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 144 - 232
Target Start/End: Complemental strand, 12958248 - 12958160
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||| |||||||| ||||| | |||||||||||||||||||||||| ||||||||||| ||| |||| ||||||||||| |
|
|
| T |
12958248 |
tacccaagagtgcttagatgagatggaactagtctcttctagcttaaccaaggtcatgggtttgaatccagcattgggcatgcagcagc |
12958160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 144 - 231
Target Start/End: Original strand, 2743911 - 2743998
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
||||||||||| |||||| ||||| | ||||||||||||||||||||||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
2743911 |
tacccaagagcatttagatgagatggaacgggtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcag |
2743998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 232
Target Start/End: Complemental strand, 13468895 - 13468820
Alignment:
| Q |
157 |
ttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||| |||||| |||| ||| ||||| |||| |||||| |
|
|
| T |
13468895 |
ttagattagatggaacgggtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgtagcagc |
13468820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 144 - 206
Target Start/End: Complemental strand, 13005832 - 13005770
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggttt |
206 |
Q |
| |
|
||||||||||||||||| | ||||| || ||||||||||||||| |||||||||||||||| |
|
|
| T |
13005832 |
tacccaagagcgcttagctgagatgtcacatgtctcttctagcttatccaaggtcttgggttt |
13005770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 230
Target Start/End: Complemental strand, 4125186 - 4125101
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
|||||||||| ||||||| ||||| | ||||||||||||||||||||| ||| |||||| |||| || ||||| ||||||||| |
|
|
| T |
4125186 |
acccaagagcacttagatgagatggaacgggtctcttctagcttaaccaatgtcctgggttcgaatcaagccttgggcatgcagca |
4125101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 232
Target Start/End: Complemental strand, 19715858 - 19715801
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||| ||| ||||| ||||||||||| |
|
|
| T |
19715858 |
gtcttttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcagc |
19715801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 33404444 - 33404379
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaat |
210 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| ||||| |||||| ||| ||||||||||| |
|
|
| T |
33404444 |
acccaagagcgcttagatgagatgacacaagtctcttatagctcaaccaaagtcatgggtttgaat |
33404379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 227
Target Start/End: Complemental strand, 4321664 - 4321584
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
||||||| | |||||| ||||||||| | | ||||||||||||| ||||| ||||||||||| ||||||| |||||||| |
|
|
| T |
4321664 |
ccaagagggtttagatgagatgacatagatttcttctagcttaagtaaggttctgggtttgaatccagtcttagacatgca |
4321584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 232
Target Start/End: Original strand, 15682938 - 15682995
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||| ||||||| || ||| |||| ||| ||||| ||||||||||| |
|
|
| T |
15682938 |
gtctcttctagcttaatcaaggtcctgagttcgaatccagccttgggcatgcagcagc |
15682995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 198
Target Start/End: Original strand, 39086797 - 39086850
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtc |
198 |
Q |
| |
|
|||||||||||||||||| ||||| | || |||||||||||||||||||||| |
|
|
| T |
39086797 |
acccaagagcgcttagatgagatggaacgggcctcttctagcttaaccaaggtc |
39086850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 219
Target Start/End: Original strand, 44705680 - 44705725
Alignment:
| Q |
174 |
ggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttg |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| ||| |||| |
|
|
| T |
44705680 |
ggtctcttctagtttaaccaaggtcttgggttcgaatccagccttg |
44705725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 228
Target Start/End: Complemental strand, 23981632 - 23981552
Alignment:
| Q |
148 |
caagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcag |
228 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| ||||||||| | ||| ||| || |||||||| |||||||||||| |
|
|
| T |
23981632 |
caagagcgcttagatcagatgacacgagtctcttttagcttaactagggttctggattcgaattcagctttggacatgcag |
23981552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 232
Target Start/End: Original strand, 35206990 - 35207066
Alignment:
| Q |
156 |
cttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||| |||||| | ||||||||||| |||||||||| | |||||| ||||| | ||||||||||||||||| |
|
|
| T |
35206990 |
cttagatgagatgaaacaggtctcttctaacttaaccaagattctgggttcgaatttaaccttggacatgcagcagc |
35207066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 141 - 232
Target Start/End: Original strand, 38766064 - 38766155
Alignment:
| Q |
141 |
gtctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||| ||||||||||||||| ||||| | |||||||||||||||||||||||| ||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
38766064 |
gtctactcaagagcgcttagatgagatggaacgagtctcttctagcttaaccaaggtcctgggtttgaatccagccttgggcatgcagcagc |
38766155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 143 - 232
Target Start/End: Original strand, 13686578 - 13686667
Alignment:
| Q |
143 |
ctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| |||||||||| |||||||||||||| |||||| |||| || ||||| | ||||||||| |
|
|
| T |
13686578 |
ctacccaagagcgcttagatgagatggcatgggtctcttcttgcttaaccaaggtcctgggttcgaatccatccttgggcgtgcagcagc |
13686667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 147 - 219
Target Start/End: Original strand, 7096077 - 7096149
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttg |
219 |
Q |
| |
|
|||||| ||||||||| |||||||| ||| |||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
7096077 |
ccaagaacgcttagatgagatgacacaggtttcttctagcttaaccaaggttttgggtttgaatacagtcttg |
7096149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 144 - 231
Target Start/End: Complemental strand, 31307229 - 31307142
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
||||||||||| ||||||| ||||| | ||||||||||||||||||||||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
31307229 |
tacccaagagcacttagatgagatggaacgggtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcag |
31307142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 233
Target Start/End: Original strand, 11140436 - 11140524
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagct |
233 |
Q |
| |
|
|||||||||||||||||| |||| ||| | | ||||||||||||||||||||| ||| || |||| ||| ||||| |||||||||||| |
|
|
| T |
11140436 |
acccaagagcgcttagataagataacacggctatcttctagcttaaccaaggtcctggtttcgaatccagccttgggcatgcagcagct |
11140524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 144 - 232
Target Start/End: Original strand, 35972321 - 35972409
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||||||||||||||| ||||| | || ||||||||||||||||||||||||||||| |||| ||| | ||| ||| ||||||| |
|
|
| T |
35972321 |
tacccaagagcgcttagatgagatggaacgggcctcttctagcttaaccaaggtcttgggttcgaatccagccatgggcatacagcagc |
35972409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 145 - 230
Target Start/End: Original strand, 14854584 - 14854669
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
|||||||||||||||||| ||||| | | |||||||||||||||||||||| |||||| |||| ||| ||||| ||||||||| |
|
|
| T |
14854584 |
acccaagagcgcttagatgagatggaacggttctcttctagcttaaccaaggttctgggttcgaatccagccttgggcatgcagca |
14854669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 198
Target Start/End: Complemental strand, 22189552 - 22189497
Alignment:
| Q |
143 |
ctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtc |
198 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
22189552 |
ctactcaagagcacttagatgagatgacatgagtctcttctagcttaaccaaggtc |
22189497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 45994500 - 45994583
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||||| |||||| ||||| | ||||||||||||||||||||||||| ||| || |||| ||| ||||| |||||| |
|
|
| T |
45994500 |
tacccaagagcgtttagatgagatggaacaggtctcttctagcttaaccaaggtcctggattcgaatccagccttgggcatgca |
45994583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 231
Target Start/End: Complemental strand, 35334230 - 35334174
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
||||||||||||||||||||||| | |||| | |||||| ||||| |||||||||| |
|
|
| T |
35334230 |
gtctcttctagcttaaccaaggttcttggttcgtattcagccttgggcatgcagcag |
35334174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 144 - 219
Target Start/End: Complemental strand, 17600661 - 17600586
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttg |
219 |
Q |
| |
|
||||||| |||| |||||| |||||||| |||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
17600661 |
tacccaaaagcgtttagatgagatgacacgggtctcttctagcttaaccaaggtcttgggttagaattcagccttg |
17600586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 175 - 232
Target Start/End: Original strand, 21774612 - 21774669
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
21774612 |
gtctcttctagcttaatcaaggttttgggttcgaatccagtcttggacatgcagcagc |
21774669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 145 - 228
Target Start/End: Original strand, 16756061 - 16756144
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcag |
228 |
Q |
| |
|
|||||||||||||||||| ||||| | | |||||||||||||||||||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
16756061 |
acccaagagcgcttagatgagatggaacggatctcttctagcttaaccaaggttctgggtttgaattcagcattgggcatgcag |
16756144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 36982333 - 36982416
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||| ||||| | |||||| |||||||| |||||||||||| ||||||||||||| ||||| |||||||| ||| |||||||| |
|
|
| T |
36982333 |
tacctaagagagtttagatgagatgacacaggtctcttctagtttaaccaaggtctcgggttcgaattcagccttagacatgca |
36982416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 145 - 231
Target Start/End: Original strand, 45806215 - 45806301
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
||||| |||||||||||| |||| | ||||||||||| ||||||||||||| || ||| |||||||||||||| |||||||||| |
|
|
| T |
45806215 |
acccaggagcgcttagatgagatagaacgggtctcttctatcttaaccaaggtcctgagttcgaattcagtcttgggcatgcagcag |
45806301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 175 - 232
Target Start/End: Original strand, 52957423 - 52957480
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
52957423 |
gtctcttttagtataaccaaggtcttgggtttgaattcagtcttaggcatgcagcagc |
52957480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 144 - 232
Target Start/End: Original strand, 22022098 - 22022186
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||| |||||| ||||| | |||||||||||||||||| ||||| |||||| |||| ||| ||||| ||||||||||| |
|
|
| T |
22022098 |
tacccaagagcgtttagatgagatggaacaggtctcttctagcttaactaaggttgtgggttcgaatccagccttgggcatgcagcagc |
22022186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 147 - 225
Target Start/End: Original strand, 10840998 - 10841076
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatg |
225 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||| |||||||||| | ||||||| ||||||| ||||| |||| |
|
|
| T |
10840998 |
ccaagagcgcttagatgagatgaaacaggtctcttctatcttaaccaagattttgggttcaaattcagccttgggcatg |
10841076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 227
Target Start/End: Complemental strand, 9639713 - 9639631
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||| |||||||||| || |||||||||||| || ||||| |||||| |
|
|
| T |
9639713 |
acccaagagcgcttacatgagatgacacatgtctcttcaagcttaaccagtgttttgggtttgaatctagccttggtcatgca |
9639631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 32883699 - 32883645
Alignment:
| Q |
178 |
tcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||||| | ||||||| |||| ||| |||||||||||||||| |
|
|
| T |
32883699 |
tcttctagcttaaccaagattttgggttcgaatccagcattggacatgcagcagc |
32883645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 35692467 - 35692529
Alignment:
| Q |
148 |
caagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaat |
210 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||| |||||| |||||||| |||||| ||| |||| |
|
|
| T |
35692467 |
caagagcgcttagatgagatggcatgggtcttttctagtttaaccaatgtcttgagttcgaat |
35692529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 204
Target Start/End: Complemental strand, 14500421 - 14500361
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggt |
204 |
Q |
| |
|
|||||||||| |||||||| |||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
14500421 |
tacccaagagtgcttagatgcgatggaacgggtctcttctagcttaaccaaggtcctgggt |
14500361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 145 - 230
Target Start/End: Original strand, 25084013 - 25084098
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
|||||||| | ||||||| |||||||| |||||||||||||||| ||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25084013 |
acccaagaacacttagatgagatgacacaagtctcttctagcttaatcaaagtcttgagttcgaattcagtcttggacatgcagca |
25084098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 174 - 228
Target Start/End: Complemental strand, 21029116 - 21029062
Alignment:
| Q |
174 |
ggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||| ||||| ||||||| |
|
|
| T |
21029116 |
ggtctcttctagcttaaccaaggtcttgggttcgaatccagccttgggcatgcag |
21029062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 148 - 232
Target Start/End: Original strand, 423637 - 423721
Alignment:
| Q |
148 |
caagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||||||||||| ||||| | | |||||||||| ||||||||||| |||||||||||| ||| ||||| ||||| ||||| |
|
|
| T |
423637 |
caagagcgcttagatgagatggaacagatctcttctagtttaaccaaggttttgggtttgaatccagccttgggcatgctgcagc |
423721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 227
Target Start/End: Original strand, 278374 - 278453
Alignment:
| Q |
148 |
caagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||| |||||| |||||||| ||||||||||||||||| ||||||||| |||||||| ||| |||| |||||| |
|
|
| T |
278374 |
caagagcgtttagatgagatgacacgagtctcttctagcttaactaaggtcttgagtttgaatccagctttgggcatgca |
278453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 230
Target Start/End: Complemental strand, 15614705 - 15614650
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
15614705 |
gtctcttctaacttaaccaatgtcatgggttcgaattcagtcttggacatgtagca |
15614650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 21910183 - 21910266
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||||| |||||| |||||| | ||||||||||||||||||||| || |||||| |||| ||| ||||| |||||| |
|
|
| T |
21910183 |
tacccaagagcgtttagatgagatgaaacaagtctcttctagcttaaccaagatcctgggttcgaatccagccttgggcatgca |
21910266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 232
Target Start/End: Original strand, 12411125 - 12411214
Alignment:
| Q |
143 |
ctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||| ||||| |||||||| ||||| | ||||||||||| ||||||||||||| || ||| |||| ||| ||||| ||||||||||| |
|
|
| T |
12411125 |
ctacctaagagtgcttagatgagatggaacaggtctcttctaacttaaccaaggtcctgagttcgaatccagccttgggcatgcagcagc |
12411214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 225
Target Start/End: Original strand, 5944821 - 5944901
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatg |
225 |
Q |
| |
|
||||||||| ||||| || |||||| | |||||||| || ||||||||||||| || ||| |||||||||||| |||||| |
|
|
| T |
5944821 |
acccaagagtgcttatataagatgatacgggtctcttttaacttaaccaaggtcctgagttcgaattcagtctttgacatg |
5944901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 8507202 - 8507136
Alignment:
| Q |
148 |
caagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcag |
214 |
Q |
| |
|
|||||||| |||||| |||||||| || | ||||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
8507202 |
caagagcgtttagatgagatgacaccgatttcttctagcttaattaaggttttgggttcgaattcag |
8507136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 231
Target Start/End: Original strand, 28099250 - 28099308
Alignment:
| Q |
173 |
cggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
|||||||||||| |||||| |||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
28099250 |
cggtctcttctaccttaactaaggtcctgggttcgaatccagccttgggcatgcagcag |
28099308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 15)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 145 - 230
Target Start/End: Complemental strand, 42745278 - 42745193
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||| ||||||||||||||||||||||| |||| ||| ||||| ||||||||| |
|
|
| T |
42745278 |
acccaagagcgcttagatgagatggaacgggtctcttatagcttaaccaaggtcttgggttcgaatccagccttgggcatgcagca |
42745193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 148 - 232
Target Start/End: Original strand, 993736 - 993820
Alignment:
| Q |
148 |
caagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| |||||||||||||||| |||||| ||||||| ||||| ||||||||||| |
|
|
| T |
993736 |
caagagcgcttagatgagatgacacgtgtctcttatagcttaaccaaggtcctgggttcgaattcaaccttgggcatgcagcagc |
993820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 144 - 230
Target Start/End: Complemental strand, 12133393 - 12133307
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||||||||||||| ||||||| |||||| |||| ||| ||||||||||||||| |
|
|
| T |
12133393 |
tacccaagagcgcttagatgagatggaacgagtctcttctagcttaatcaaggtcatgggttcgaatccagccttggacatgcagca |
12133307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 230
Target Start/End: Original strand, 5394374 - 5394461
Alignment:
| Q |
143 |
ctacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
||||| |||||||||||||| ||||| | |||||||||||||||||||||||| |||||| |||| ||| ||||| ||||||||| |
|
|
| T |
5394374 |
ctaccaaagagcgcttagatgagatggaacgagtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagca |
5394461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 145 - 227
Target Start/End: Complemental strand, 31579391 - 31579309
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||| ||||||| ||||| | ||||||||||||||||| |||||||||||||| |||| ||| ||||| |||||| |
|
|
| T |
31579391 |
acccaagagcacttagatgagatgtaacgggtctcttctagcttaatcaaggtcttgggttcgaatccagccttgggcatgca |
31579309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 145 - 231
Target Start/End: Complemental strand, 44732735 - 44732649
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
|||||||||| ||||||| ||||| | |||||||| |||||||||||||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
44732735 |
acccaagagcacttagatgagatggaacgggtctcttatagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcag |
44732649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 232
Target Start/End: Original strand, 28365928 - 28366015
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||| ||||||||||||| || ||| |||| ||| ||||| ||||||||||| |
|
|
| T |
28365928 |
acccaagagcgcttagatgagatggaacgcgtctcttctaacttaaccaaggtcgtgagttcgaatgcagccttgggcatgcagcagc |
28366015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 156 - 230
Target Start/End: Complemental strand, 13154074 - 13154000
Alignment:
| Q |
156 |
cttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
||||||| ||||||||| |||||||||| ||||||| | || ||| |||||||| |||||||||||| |||||| |
|
|
| T |
13154074 |
cttagatgagatgacataagtctcttctaacttaacccaagttttgagtttgaatacagtcttggacacgcagca |
13154000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 145 - 231
Target Start/End: Complemental strand, 37568889 - 37568803
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
|||||||||| ||||||| ||||| | ||| ||||||||||||||||||||| |||||| |||| ||| ||| | |||||||||| |
|
|
| T |
37568889 |
acccaagagcacttagatgagatggaacgggtttcttctagcttaaccaaggtcctgggttcgaatccagccttaggcatgcagcag |
37568803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 18105494 - 18105442
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||| ||| ||||| |||||| |
|
|
| T |
18105494 |
gtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgca |
18105442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 201
Target Start/End: Complemental strand, 7020518 - 7020464
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttg |
201 |
Q |
| |
|
||||||||| |||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
7020518 |
ccaagagcgtttagatgagattgcacgggtctcttctagcttaaccaaggtcttg |
7020464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 230
Target Start/End: Complemental strand, 14122009 - 14121959
Alignment:
| Q |
180 |
ttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
||||||| |||||| |||| || ||||||||||||||||| |||||||||| |
|
|
| T |
14122009 |
ttctagcctaaccagggtcctgagtttgaattcagtcttgaacatgcagca |
14121959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 144 - 197
Target Start/End: Original strand, 33756955 - 33757008
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggt |
197 |
Q |
| |
|
||||||||| | ||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
33756955 |
tacccaagaacacttagatgagatgacacgggtctcttctagcttaatcaaggt |
33757008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 227
Target Start/End: Complemental strand, 3772703 - 3772623
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| |||||||||||| | ||| |||| || ||||| ||||||| |
|
|
| T |
3772703 |
ccaagagcgcttagatgagatgacacaagtctcttctaatttaaccaaggtcctaagttcgaatccaatcttgaacatgca |
3772623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 232
Target Start/End: Original strand, 34483448 - 34483527
Alignment:
| Q |
152 |
agcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||||||||| || | |||| |||||||||||||||||||| |||| |
|
|
| T |
34483448 |
agcgcttagataagatgacacatgtcttttctagcttaaccaaagt-tctggttcaaattcagtcttggacatgcaacagc |
34483527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 12)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 145 - 232
Target Start/End: Original strand, 25224678 - 25224765
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||||| |||||| | ||||||||||||||||||||||||| |||||| |||| ||| |||| |||||||||| |
|
|
| T |
25224678 |
acccaagagcgcttagatgagatgaaacgggtctcttctagcttaaccaaggtcctgggttcgaatcaagttttgggaatgcagcagc |
25224765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 145 - 230
Target Start/End: Complemental strand, 48204473 - 48204388
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagca |
230 |
Q |
| |
|
||||||||| |||||||| ||||| | ||||||||||||||||||||||||||||||| |||| ||| ||||| ||||||||| |
|
|
| T |
48204473 |
acccaagagtgcttagatgagatggaacgagtctcttctagcttaaccaaggtcttgggttcgaatccagccttgggcatgcagca |
48204388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 197
Target Start/End: Original strand, 38088613 - 38088666
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggt |
197 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
38088613 |
tacccaagagcgcttagatgagatgaaacgggtctcttctagcttaaccaaggt |
38088666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 14352532 - 14352615
Alignment:
| Q |
144 |
tacccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||||||||||||||||| | || |||| |||| ||| |||||||||||| |
|
|
| T |
14352532 |
tacccaagagcgcttagatgagatggaacaagtctcttctagcttaaccaagatattcggttcgaatccagccttggacatgca |
14352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 30996127 - 30996062
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaat |
210 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
30996127 |
acccaagagcgcttagatgagatggaacgggtctcttctatcttaaccaaggtcctgggttcgaat |
30996062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 220
Target Start/End: Original strand, 54877834 - 54877887
Alignment:
| Q |
167 |
tgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttgg |
220 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
54877834 |
tgacatgggtctcttctaacttaaccaaggttttgagtttgaattcagccttgg |
54877887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 22288216 - 22288296
Alignment:
| Q |
147 |
ccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||| ||||||||||| ||||||||| ||||||||| ||||||||| ||| || ||| |||||||| |||| ||||||| |
|
|
| T |
22288216 |
ccaaaagcgcttagatgagatgacatgaatctcttctaacttaaccaaagtcctgagttcgaattcagccttgaacatgca |
22288296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 232
Target Start/End: Original strand, 39950235 - 39950278
Alignment:
| Q |
189 |
aaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
||||||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
39950235 |
aaccaaggtcttgggttagaatccagttttggacatgcagcagc |
39950278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 42514586 - 42514648
Alignment:
| Q |
148 |
caagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaat |
210 |
Q |
| |
|
||||||||||||||| |||||| | ||||||||||||||||| || |||||||||| |||| |
|
|
| T |
42514586 |
caagagcgcttagatgagatgaaacgtgtctcttctagcttaactaaagtcttgggttcgaat |
42514648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 2195646 - 2195602
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttg |
219 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
2195646 |
gtctcttctagcttaactaaggttctgagtttgaattcagtcttg |
2195602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 9651059 - 9651111
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||| |||| || ||||||||||| |||||||| |||||||||||| |
|
|
| T |
9651059 |
gtctcttctaatttaatcatggtcttgggttcgaattcagccttggacatgca |
9651111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 50518686 - 50518634
Alignment:
| Q |
175 |
gtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgca |
227 |
Q |
| |
|
|||||||||| |||||| || ||| || ||| ||||||||||||||||||||| |
|
|
| T |
50518686 |
gtctcttctaacttaactaatgtcatgtgttcgaattcagtcttggacatgca |
50518634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 26339 - 26396
Alignment:
| Q |
174 |
ggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcag |
231 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| ||| ||||| |||||||||| |
|
|
| T |
26339 |
ggtctcttctagcttaaccaaggtcctgggttcgaatccagccttgggcatgcagcag |
26396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 145 - 232
Target Start/End: Original strand, 167834 - 167919
Alignment:
| Q |
145 |
acccaagagcgcttagattagatgacatcggtctcttctagcttaaccaaggtcttgggtttgaattcagtcttggacatgcagcagc |
232 |
Q |
| |
|
|||||||||||||||||| |||||| | ||||||||||||||||| ||||||| ||||| ||| ||| ||||| ||||||||||| |
|
|
| T |
167834 |
acccaagagcgcttagatgagatgaaacgggtctcttctagcttaatcaaggtc--gggttcaaatccagccttgggcatgcagcagc |
167919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University