View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3794_high_4 (Length: 522)
Name: NF3794_high_4
Description: NF3794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3794_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 16 - 506
Target Start/End: Original strand, 8375265 - 8375758
Alignment:
| Q |
16 |
ggcagatggtgaggtcatgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcaactttaatttctgtttcttcttcttggataagacg |
115 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
8375265 |
ggcagatggtgagctcacgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcagttttaatttctgtttcttcttcttgaataagacg |
8375364 |
T |
|
| Q |
116 |
ggtgtgaaaggagcttaaactaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgtttacaac |
215 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8375365 |
ggtgtgaaaggagcttcagctaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgttcacaac |
8375464 |
T |
|
| Q |
216 |
tctctccttgtatgacaatgtttccatcaataggtgccacat---aagttggaattaaagcaatgtctgtcggaacaacattcagccccaccccttgcat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || || ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8375465 |
tctctccttgtatgacaatgtttccatcaataggtgtcatatcagaagttcgaattaaagcaatgtctgtcggaacaacattcagctccaccccttgcat |
8375564 |
T |
|
| Q |
313 |
gacaatggtgttgttcacggggggaatatcacttggggaaccaattccaacataggactagccgactaagtgagagccccatgaggaattacatcagaca |
412 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8375565 |
gacaatggtgttattcacggggggaatatcacttagggaaccaattccaacataggactagtcgactaagggagagccccatgaggaattacatcagaca |
8375664 |
T |
|
| Q |
413 |
cattttgtacggcaaaactgaaggaattcgagacccttgctgcaaaagtacttgcaaccggcgtctatattgcttgcaactcaggactgttttg |
506 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
8375665 |
cattttgtagggcaaaactaaaggaattcgagaaccttgctgcaaaagtacttgcaaccggtgtctatattgcttgcaactcgggactgttttg |
8375758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 343 - 440
Target Start/End: Original strand, 18145337 - 18145434
Alignment:
| Q |
343 |
acttggggaaccaattccaacataggactagccgactaagtgagagccccatgaggaattacatcagacacattttgtacggcaaaactgaaggaatt |
440 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| || || || | | || ||||||||||| |||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
18145337 |
acttggggaatcaattccaacacaggactagtcgtctcaggcaaatccacatgaggaatttcatcagacacatcttgtagttcaaaactgaaagaatt |
18145434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University