View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3795_high_25 (Length: 242)
Name: NF3795_high_25
Description: NF3795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3795_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 14334572 - 14334776
Alignment:
| Q |
18 |
taatggttttccatttttaaagaaatttagattaagaggtgggaggttagagaaaactgtcaatctcatcaagaatttagaatgaaatttacgtgtaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
14334572 |
taatggttttccatttttaaagaaatttagattaagaggtgggaagttagagaaaaatgtcaatctcatcaagaatttccaatgaaattta------agt |
14334665 |
T |
|
| Q |
118 |
gtaacttatcataatttatcaattacaaaataaaagattagaactcaagtcagagttggtgtaaggtgagggtctaaccatttgtgtctaccataattgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14334666 |
gtaacttatcataatttatcaattacaaaataaaagattagaactcaagtcagagttggtgtaaggtgagggtctaaccatttgtgtctatcataattgg |
14334765 |
T |
|
| Q |
218 |
tttaatctgtg |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
14334766 |
tttaatctgtg |
14334776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University