View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3795_high_26 (Length: 240)
Name: NF3795_high_26
Description: NF3795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3795_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 34304358 - 34304114
Alignment:
| Q |
1 |
atgagtgtgtctagttttcttttaagtgtgtcggtgtcataatgggtctttttgttgctgctgctgttgttg---ttgtgatggatatagtcttcgctct |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
34304358 |
atgagtgtgtctagttttcttttaagtgtgtcggtgtcataatgggtctttttgttgctactgttgttgttgttgttgtgatggatatagtcttcactct |
34304259 |
T |
|
| Q |
98 |
tctagtgtgtctaga---nnnnnnnnnagtgtgtctagtgttgtaatgggtattgtaatggttttttgtgtctctataaa--ttctct-------tttga |
185 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
34304258 |
tctagtgtgtctagattttttttttttagtgtgtctagtgttgtaatgggtattgtaatggttttttgtgtctctataaaacttctctttttatgtttga |
34304159 |
T |
|
| Q |
186 |
tatttgttgaaagtattatattgtcattgaatattgtcttctgtg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34304158 |
tatttgttgaaagtattatattgtcattgaatattgtcttctgtg |
34304114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University