View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3795_high_27 (Length: 240)

Name: NF3795_high_27
Description: NF3795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3795_high_27
NF3795_high_27
[»] chr6 (1 HSPs)
chr6 (28-226)||(28539958-28540156)


Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 28 - 226
Target Start/End: Complemental strand, 28540156 - 28539958
Alignment:
28 agccgatgtcagatctggtctgattccggtaccgcctagtaccggtgatctacatggactcagaggcggtgataatccgttttctataacttctgatcga 127  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||    
28540156 agccgatgtcagatctggtctgattccggtaccgcttagtaccggtgatctacatggactcataggtggtgataatccgttttctataacttctgatcga 28540057  T
128 gttacttgacaacgtagattcgttgctggtgttttccatattgctgctgcgttcatggaagctgttgttggctctgttgatgttgattcaatcggtatc 226  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28540056 gttacttgacaacgtagattcgttgctggtgttttccatactgctgctgcgttcatggaagctgttgttggctctgttgatgttgattcaatcggtatc 28539958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University