View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3795_high_27 (Length: 240)
Name: NF3795_high_27
Description: NF3795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3795_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 28 - 226
Target Start/End: Complemental strand, 28540156 - 28539958
Alignment:
| Q |
28 |
agccgatgtcagatctggtctgattccggtaccgcctagtaccggtgatctacatggactcagaggcggtgataatccgttttctataacttctgatcga |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28540156 |
agccgatgtcagatctggtctgattccggtaccgcttagtaccggtgatctacatggactcataggtggtgataatccgttttctataacttctgatcga |
28540057 |
T |
 |
| Q |
128 |
gttacttgacaacgtagattcgttgctggtgttttccatattgctgctgcgttcatggaagctgttgttggctctgttgatgttgattcaatcggtatc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28540056 |
gttacttgacaacgtagattcgttgctggtgttttccatactgctgctgcgttcatggaagctgttgttggctctgttgatgttgattcaatcggtatc |
28539958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University