View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3795_low_19 (Length: 294)
Name: NF3795_low_19
Description: NF3795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3795_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 17 - 283
Target Start/End: Complemental strand, 9534255 - 9533989
Alignment:
| Q |
17 |
caaaaacaccgttgttctttttgaggtttttcatcatcgttttcactctcatcacaaacccctttttcactctcaaaagggttttcaaccattttcttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9534255 |
caaaaacaccgttgttctttttgaggtttttcatcatcgttttcactctcatcacaaacccctttttcactctcaaaagggttttcaaccattttcttca |
9534156 |
T |
|
| Q |
117 |
aaccctccttttcacccttcaaaatcctctctttctctctcatccattgccttgaaccccacttcacaaaacctgggtttttgtttttccacaacataaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9534155 |
aaccctccttttcacccttcaaaatcctctctttctctctcatccattgccttgaaccccacttcacaaaacctgggtttttgtttttccacaacataaa |
9534056 |
T |
|
| Q |
217 |
catcatatgacgtagtacgatgaatgaaccttaatccttgttttgttgttttcctttggttttgatg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9534055 |
catcatatgacgtagtacgatgaatgaaccttaatccttgttttgttgttttcctttggttttgatg |
9533989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University