View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3795_low_32 (Length: 237)
Name: NF3795_low_32
Description: NF3795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3795_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 38796684 - 38796520
Alignment:
| Q |
1 |
atgtacgagttatttgtaaccaaaagaggaaatgtggttaaaatatttcaatatgttgtaagcgattttcataactaggcatcatgggaagctaaatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38796684 |
atgtacgagttatttgtaaccaaaagaggaaatgtggttaaaatatttcaatatgttgtaagcgattttcataactaggcatcatgggaagctaaatgct |
38796585 |
T |
 |
| Q |
101 |
aattgaaatttataggtgttgggaaagcaacaaaaggaatatctacactagcagcacactaacat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38796584 |
aattgaaatttataggtgttgggaaagcaacaaaaggaatatctacactagcagcacactaacat |
38796520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Complemental strand, 38796497 - 38796463
Alignment:
| Q |
188 |
cacaatcacaaataaattgtgttttgacactttat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38796497 |
cacaatcacaaataaattgtgttttgacactttat |
38796463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University