View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3796_high_9 (Length: 343)
Name: NF3796_high_9
Description: NF3796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3796_high_9 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 138 - 343
Target Start/End: Original strand, 32838148 - 32838353
Alignment:
| Q |
138 |
gcttgtctttttccaattgaactgcaatacccttcatcacaccaactgttgaacggatatcctaaaacaaacccagaaaaatgtaacacaataagtgata |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32838148 |
gcttgtctttttccaattgaactgcaatacccttcatcacaccaactgttgaacggatatcctaaaacaaacccagaaaaatgtaacacaataagtgata |
32838247 |
T |
 |
| Q |
238 |
aacaaaatgattgaatttatttacaaacacgaaaaaatgctcctttgattaaaggataccctaaaaaagaagggtttgagagtttacagagatgataggt |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32838248 |
aacaaaatgattgaatttatttacaaacacgaaaaaatgctcctttgattaaaggataccctaaaaaagaagggtttgagagtttacagagatgataggt |
32838347 |
T |
 |
| Q |
338 |
tgaata |
343 |
Q |
| |
|
|||||| |
|
|
| T |
32838348 |
tgaata |
32838353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 11 - 60
Target Start/End: Original strand, 32838020 - 32838069
Alignment:
| Q |
11 |
cataggctaaaatggtttttattgttcgctcatcacatgaccaatattac |
60 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32838020 |
cataggctaaaatggtttttattgttcactcatcacatgaccaatattac |
32838069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University