View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3798_low_6 (Length: 316)
Name: NF3798_low_6
Description: NF3798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3798_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 40517079 - 40517381
Alignment:
| Q |
1 |
aactgcgccgccaggcctttttggatggtatagtacttgcattcgggttatccaaatctcaacaattccaactaatgatactcaatactcttggcagaag |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40517079 |
aactgcgccgtcaggcctttttggatggcatagtacttgcattcgggttatccaaatctcaacaattccaactaatgatactcaatactcttggcagaag |
40517178 |
T |
 |
| Q |
101 |
accgggaaacaatgacttgccaataaaaaatgctgaaactgtaggcttgagcttacatttgcagtgttattttttcccacttgcatggctacacattaat |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40517179 |
accgggaaacaatgacttgcgcataaaaaatgctgaaactgtgggcatgagcttacatttgcagtgttattttttcccacttgcatggctacacattaat |
40517278 |
T |
 |
| Q |
201 |
tgtcattccgatcctaatcttcctctcnnnnnnnncttcttccaagttttaacaacgtgcactccatcatgggtgtaattgcgagagcatatatgtaatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
40517279 |
tgtcattccgatcctaatcttcctctcttttttttcttcttccaagttttaacaacgtgcactccatcatgggtgtaattgcgagatcatatatttaatt |
40517378 |
T |
 |
| Q |
301 |
aat |
303 |
Q |
| |
|
||| |
|
|
| T |
40517379 |
aat |
40517381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University