View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3799_high_12 (Length: 238)
Name: NF3799_high_12
Description: NF3799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3799_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 4775901 - 4775696
Alignment:
| Q |
16 |
tcaactgaagctgaatatcgtactatagcagccactactcaagaattaatatgggttcaaaacttgttacaagaacttcaaattccattaacggcaccaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4775901 |
tcaactgaagctgaatatcgtactatagcagccactactcaagaattaatatgggttcaaaacttgttacaagaacttcaaattccattaactgcaccaa |
4775802 |
T |
 |
| Q |
116 |
caatattcttagaaaacattggagctacatctctatgtgcaaaccctgtctttcagtactctaggatgaagcatattgccatagattatcattttgttcg |
215 |
Q |
| |
|
||||||||| ||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4775801 |
caatattctaagacaacattggagctacatatctatgtgcaaaccctgtctttc---actctaggatgaagcatattgccatagattatcattttgttcg |
4775705 |
T |
 |
| Q |
216 |
cgatctcgt |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
4775704 |
cgatctcgt |
4775696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 43061266 - 43061057
Alignment:
| Q |
12 |
atcatcaactgaagctgaatatcgtactatagcagccactactcaagaattaatatgggttcaaaacttgttacaagaacttcaaattccattaacggca |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43061266 |
atcatcaactgaagctgaatatcggactatagcagccactactcaggaattaatatgggttcaaaacttgttacaagaacttcaaattccattaactgca |
43061167 |
T |
 |
| Q |
112 |
ccaacaatattcttagaaaacattggagctacatctctatgtgcaaaccctgtctttcagtactctaggatgaagcatattgccatagattatcattttg |
211 |
Q |
| |
|
||||| ||||||| ||| |||||| ||||||||| |||||||||||||||||| |||| ||| ||||||||| || |||||||||||||||||||||| |
|
|
| T |
43061166 |
ccaacgatattctcagacaacattagagctacatatctatgtgcaaaccctgtttttc---actataggatgaaacacattgccatagattatcattttg |
43061070 |
T |
 |
| Q |
212 |
ttcgcgatctcgt |
224 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
43061069 |
tttgcgatctcgt |
43061057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 170
Target Start/End: Original strand, 45192874 - 45192914
Alignment:
| Q |
130 |
aacattggagctacatctctatgtgcaaaccctgtctttca |
170 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
45192874 |
aacattggagctacatatctatgtgcaaaccctgtccttca |
45192914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University