View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3799_high_2 (Length: 368)
Name: NF3799_high_2
Description: NF3799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3799_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 77 - 335
Target Start/End: Original strand, 4283814 - 4284072
Alignment:
| Q |
77 |
atataattgtaacatctgtcttttaatgctgttgagtggagcggtaacatggtgtcatatttgtatcaaattgacggacaatatattgaatgaccaaatt |
176 |
Q |
| |
|
||||| ||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4283814 |
atatagttgcaacatctgtctttttattttgttgagtggagcggtaacatggtgtcatatttgtatcaaattgacggacaatatattgaatgaccaaatt |
4283913 |
T |
|
| Q |
177 |
aattaatactactgttagtaagttgtcaaattgagtatagtaaataactttggcagaatcataaataaagccacatcaatgaaccaaaagaagcatgaca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4283914 |
aattaatactactgttagtaagttgtcaaattgagtatagtaaataactttggcagaatcataaataaagccacatcaatgaaccaaaagaagcatgaca |
4284013 |
T |
|
| Q |
277 |
gtaaagccagcaagcagtttgggcaccatgcttgcatactttgcaaccggcaatttcat |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284014 |
gtaaagccagcaagcagtttgggcaccatgcttgcatactttgcaaccggcaatttcat |
4284072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University