View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3799_high_4 (Length: 299)
Name: NF3799_high_4
Description: NF3799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3799_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 27 - 261
Target Start/End: Original strand, 9975483 - 9975715
Alignment:
| Q |
27 |
agaagttgtatgagatttgtgagtgtgcatctgaatctctgttgcctgtataattattttgtggaaacatggaatattagttaatggttggtttggtacg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9975483 |
agaagttgtatgagatttgtgagtgtgcatctgaatctctgttgcctgtataattattttgtggaaacatggaatattagttaatggttggtttggtacg |
9975582 |
T |
 |
| Q |
127 |
ttatcattgtnnnnnnnnnnnnnngatacaaatcatatggaagtgttggaagtatttaatatataatacatgataaaacataagt-nnnnnnnntaatat |
225 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
9975583 |
ttatcattgt---aaaaacaattagatacaaatcatatggaagtgttggaagtatttaatatataatatatgataaaacataagtaaaaaaaaaaaatat |
9975679 |
T |
 |
| Q |
226 |
gaacatgataatagaggctacttatccatatgattt |
261 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9975680 |
gaacatgataatataggctacttatccatatgattt |
9975715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 27 - 77
Target Start/End: Complemental strand, 7113103 - 7113053
Alignment:
| Q |
27 |
agaagttgtatgagatttgtgagtgtgcatctgaatctctgttgcctgtat |
77 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
7113103 |
agaagttgtatggaatttgtgagtgtgcatctgaatctccgttgcttgtat |
7113053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 70
Target Start/End: Complemental strand, 19855814 - 19855786
Alignment:
| Q |
42 |
tttgtgagtgtgcatctgaatctctgttg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19855814 |
tttgtgagtgtgcatctgaatctctgttg |
19855786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University