View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3800_high_9 (Length: 320)
Name: NF3800_high_9
Description: NF3800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3800_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 148 - 305
Target Start/End: Original strand, 452599 - 452745
Alignment:
| Q |
148 |
cttttaacctaaggcttgatgattgaaaatgtaactaaccgtagtcgagtgaataagcaaaccaaagtccaaa-gggatacataaaaatggaatgtatgg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
452599 |
cttttaacctaaggcttgatgattgaaaatgtaaataacc-----------aagcagcaaaccaaagtccaaaagggatacataaaaatggaatgtatgg |
452687 |
T |
|
| Q |
247 |
ttaagttagtcaggacatcaattttggttacatgtctcattgtttcagtctggtaaggt |
305 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
452688 |
ttaagttagtcaggacatcaa-tttggttacatgtctcattctttcagtctggtaaggt |
452745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 20 - 89
Target Start/End: Original strand, 452473 - 452546
Alignment:
| Q |
20 |
aaaggtcgaacgaatgaatgaaatgtttctttctt----tgttggaggttcatttatagtaaaggatattcacg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
452473 |
aaaggtcgaacgaatgaatgaaatgtttctttcttaatttgttggaggttcatttatagtaaaggatattcacg |
452546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University