View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3800_low_10 (Length: 288)
Name: NF3800_low_10
Description: NF3800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3800_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 270
Target Start/End: Original strand, 38070744 - 38071003
Alignment:
| Q |
12 |
agagagacgtgtttggattcatatgccagaagtgttaaatggaagagaagcaaaaggtgtcgtgtgcatgaaaatcaaacggtattattgctttatattg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38070744 |
agagagacgtgtttggattcatatgccagaagtgttaaatggaagagaagcaaaaggtgtcgtgtgcatgaaaatcaaacggtattattgctttatattg |
38070843 |
T |
 |
| Q |
112 |
ccacatatataatagnnnnnnnn-tagatatttatctttaatttgactctatatcaagaactttaatgtgtattattctttttaatttatcctatagaat |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38070844 |
ccacatatataatagaaaaaaaaatagatatttatctttaatttgactctatattaagaactttaatgtgtattattctttttactttatcctatagaat |
38070943 |
T |
 |
| Q |
211 |
ttattatcatattaaatttgtatatttggttgaattcatacttacaaaattggtttgtaa |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38070944 |
ttattatcatattaaatttgtatatttggttgaattcatacttacaaaattggtttgtaa |
38071003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University