View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3800_low_12 (Length: 265)
Name: NF3800_low_12
Description: NF3800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3800_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 7157573 - 7157404
Alignment:
| Q |
1 |
ctctctaaaaatttaatgtgacaatgacataattt---------ttatgaatttattattatcacttctattttttcttaaaagattgcacctgctttat |
91 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7157573 |
ctctctaaatatttaatgtgacaatgacataatttattaattttttatgaatttattatcatcacttctattttttcttaaaagattgcacctgctttat |
7157474 |
T |
 |
| Q |
92 |
gaacgaataatttattgnnnnnnnaaaaatgcaagataatagttcactttaaaatctcctgttatattct |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7157473 |
gaacgaataatttattgtttttttaaaaatgcaagataatagttcactttaaaatctccttttatattct |
7157404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University