View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3800_low_13 (Length: 262)
Name: NF3800_low_13
Description: NF3800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3800_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 10 - 149
Target Start/End: Complemental strand, 2833224 - 2833085
Alignment:
| Q |
10 |
aagaatatagaagaacaatggaaacaaataaagggtagaagagaagttttgatatcatcacctaaataaagttagagagaatgaaaggcaagtctggttt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2833224 |
aagaatatagaagaacaatggaaacaaataaagggtagaagagaagtattgatatattcacctaaatagagttagagagaatgaaaggcaagtctggttt |
2833125 |
T |
|
| Q |
110 |
gaagaattaatcatttgatgtcgtttcatatgaaaatgag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833124 |
gaagaattaatcatttgatgtcgtttcatatgaaaatgag |
2833085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University