View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3801_high_14 (Length: 362)
Name: NF3801_high_14
Description: NF3801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3801_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 32838354 - 32838148
Alignment:
| Q |
19 |
atattcaacctatcatctctgtaaactctcaaacccttcttttttagggtatcctttaatcaaaggagcattttttcgtgtttgtaaataaattcaatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32838354 |
atattcaacctatcatctctgtaaactctcaaacccttcttttttagggtatcctttaatcaaaggagcattttttcgtgtttgtaaataaattcaatca |
32838255 |
T |
 |
| Q |
119 |
ttttgtttatcacttattgtgttacatttttctgggtttgttttaggatatccgttcaacagttggtgtgatgaagggtattgcagttcaattggaaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32838254 |
ttttgtttatcacttattgtgttacatttttctgggtttgttttaggatatccgttcaacagttggtgtgatgaagggtattgcagttcaattggaaaaa |
32838155 |
T |
 |
| Q |
219 |
gacaagc |
225 |
Q |
| |
|
||||||| |
|
|
| T |
32838154 |
gacaagc |
32838148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 303 - 352
Target Start/End: Complemental strand, 32838069 - 32838020
Alignment:
| Q |
303 |
gtaatattggtcatgtgatgagcgaacaataaaaaccattttagcctatg |
352 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32838069 |
gtaatattggtcatgtgatgagtgaacaataaaaaccattttagcctatg |
32838020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University