View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3801_high_35 (Length: 220)

Name: NF3801_high_35
Description: NF3801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3801_high_35
NF3801_high_35
[»] chr4 (2 HSPs)
chr4 (19-206)||(24860242-24860418)
chr4 (19-147)||(34748499-34748627)
[»] chr8 (6 HSPs)
chr8 (19-146)||(26591913-26592040)
chr8 (21-148)||(25865443-25865570)
chr8 (32-145)||(43479943-43480056)
chr8 (32-144)||(38799242-38799354)
chr8 (32-144)||(38822163-38822275)
chr8 (26-148)||(41943687-41943809)
[»] chr5 (3 HSPs)
chr5 (32-144)||(12531239-12531351)
chr5 (32-144)||(12547268-12547380)
chr5 (19-129)||(9866914-9867024)
[»] chr2 (5 HSPs)
chr2 (19-145)||(13576094-13576220)
chr2 (88-148)||(34571801-34571861)
chr2 (88-148)||(34562977-34563037)
chr2 (21-148)||(34579172-34579299)
chr2 (21-148)||(34584921-34585048)
[»] scaffold0197 (1 HSPs)
scaffold0197 (19-145)||(30758-30884)
[»] chr7 (2 HSPs)
chr7 (19-145)||(21317320-21317446)
chr7 (68-146)||(3930266-3930344)
[»] chr1 (1 HSPs)
chr1 (83-144)||(7594916-7594977)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 24860418 - 24860242
Alignment:
19 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24860418 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 24860319  T
119 cgagctgtttgctttgtacgagccattgaaattggaatgaaattgaaatttgaatgaaatgagatttgagttatgctgtgtgtctgtg 206  Q
    ||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||| ||||| ||||    
24860318 cgagctgtttgctttgtacgagccattgaa-----------attgaaatttgaatgaaatgagatttgagttatgctatgtgtttgtg 24860242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 147
Target Start/End: Complemental strand, 34748627 - 34748499
Alignment:
19 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 118  Q
    |||||||||||||||||||||||| |||||||| ||||| ||||| || ||||||||||| ||||| ||||||||||| ||||| ||||| |||||||||    
34748627 gaaacggtgaggtttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagctttacctccagtggatttg 34748528  T
119 cgagctgtttgctttgtacgagccattga 147  Q
    ||||| |||||||| ||||| ||||||||    
34748527 cgagcggtttgcttggtacgtgccattga 34748499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 26592040 - 26591913
Alignment:
19 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 118  Q
    ||||||||| || ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||||||||||||| || |||||||| |||    
26592040 gaaacggtgtggcttcttcactccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgcttccttggtgctttgccgccggtggacttg 26591941  T
119 cgagctgtttgctttgtacgagccattg 146  Q
    || || |||||||| ||||| |||||||    
26591940 cgtgcagtttgcttagtacgtgccattg 26591913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 21 - 148
Target Start/End: Complemental strand, 25865570 - 25865443
Alignment:
21 aacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcg 120  Q
    |||| ||||| ||||||||||||||||||| |||||| |||||||  || ||||| || || || |||||||||||||| || || ||||||||||||||    
25865570 aacgatgaggcttcttcactccgccggtggttggagcagatttccttgcagctttggtcgcgagttgcttccttggtgccttgccgccggtggatttgcg 25865471  T
121 agctgtttgctttgtacgagccattgaa 148  Q
    ||| |||||||| |||||||||||||||    
25865470 agcagtttgcttcgtacgagccattgaa 25865443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 32 - 145
Target Start/End: Original strand, 43479943 - 43480056
Alignment:
32 ttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgct 131  Q
    ||||||||||| |||||||| ||||| |||||||| |||||||| || || || || |||||||| ||||| || ||||||||||||||||| ||||| |    
43479943 ttcttcactcctccggtggccggagctgatttccgagcggctttggtggcgagttgtttccttggagctttgccaccggtggatttgcgagcggtttgtt 43480042  T
132 ttgtacgagccatt 145  Q
    | ||||||||||||    
43480043 tggtacgagccatt 43480056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 32 - 144
Target Start/End: Complemental strand, 38799354 - 38799242
Alignment:
32 ttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgct 131  Q
    ||||||||||| ||||| || ||||| |||||||| ||||| || || || ||||||||||  || || || || |||||||||||||||||||||||||    
38799354 ttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgct 38799255  T
132 ttgtacgagccat 144  Q
    | ||||| |||||    
38799254 tggtacgtgccat 38799242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 32 - 144
Target Start/End: Original strand, 38822163 - 38822275
Alignment:
32 ttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgct 131  Q
    ||||||||||| ||||| || ||||| |||||||| ||||| || || || ||||||||||  || || || || |||||||||||||||||||||||||    
38822163 ttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctgtttgct 38822262  T
132 ttgtacgagccat 144  Q
    | ||||| |||||    
38822263 tggtacgtgccat 38822275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 41943809 - 41943687
Alignment:
26 tgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctg 125  Q
    ||||||||||| ||||| ||||| |  ||||| ||||| || || || || || || || ||||||||||| || || || ||||||||||||||||| |    
41943809 tgaggtttcttgactccaccggttgtaggagcagatttgcgagcagccttggtggccagttgcttccttggagccttgccaccggtggatttgcgagcag 41943710  T
126 tttgctttgtacgagccattgaa 148  Q
    ||||||| |||||||||||||||    
41943709 tttgcttagtacgagccattgaa 41943687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 32 - 144
Target Start/End: Complemental strand, 12531351 - 12531239
Alignment:
32 ttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgct 131  Q
    ||||| ||||| ||||| || ||||| ||||||||||| ||||| || || ||||||||||||||||||||||| |||||||||||||||||||||||||    
12531351 ttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgct 12531252  T
132 ttgtacgagccat 144  Q
    | |||||||||||    
12531251 tggtacgagccat 12531239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 32 - 144
Target Start/End: Original strand, 12547268 - 12547380
Alignment:
32 ttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgct 131  Q
    ||||| ||||| ||||| || ||||| ||||||||||| ||||| || || ||||||||||||||||||||||| |||||||||||||||||||||||||    
12547268 ttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgct 12547367  T
132 ttgtacgagccat 144  Q
    | |||||||||||    
12547368 tggtacgagccat 12547380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 129
Target Start/End: Original strand, 9866914 - 9867024
Alignment:
19 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 118  Q
    ||||||||| || ||||||||||| || || || ||||| |||||||| || |||||||| || |||| ||| | ||||||||| || ||||||||||||    
9866914 gaaacggtgtggcttcttcactcctcccgttgccggagctgatttccgagcagcttttgtggccagcttctttcatggtgctttaccgccggtggatttg 9867013  T
119 cgagctgtttg 129  Q
    ||||| |||||    
9867014 cgagccgtttg 9867024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 145
Target Start/End: Complemental strand, 13576220 - 13576094
Alignment:
19 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 118  Q
    |||||| || || ||||||||||| |||||||| |||||||||||||| ||||||||||| || || || || | |||||||||||| ||||||||||||    
13576220 gaaacgatgtggcttcttcactcctccggtggccggagcggatttccgagcggcttttgtggcgagttgtttgcgtggtgcttttccgccggtggatttg 13576121  T
119 cgagctgtttgctttgtacgagccatt 145  Q
    || |||||||| || ||||| ||||||    
13576120 cgggctgtttgtttggtacgtgccatt 13576094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 88 - 148
Target Start/End: Original strand, 34571801 - 34571861
Alignment:
88 cttccttggtgcttttcctccggtggatttgcgagctgtttgctttgtacgagccattgaa 148  Q
    |||||||||||| || || ||||||||||||||||| |||||||||||||| |||||||||    
34571801 cttccttggtgccttgccaccggtggatttgcgagcagtttgctttgtacgcgccattgaa 34571861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 88 - 148
Target Start/End: Original strand, 34562977 - 34563037
Alignment:
88 cttccttggtgcttttcctccggtggatttgcgagctgtttgctttgtacgagccattgaa 148  Q
    |||| ||||||| || || ||||||||||||||||| |||||||||||||| |||||||||    
34562977 cttcgttggtgccttgccaccggtggatttgcgagcagtttgctttgtacgcgccattgaa 34563037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 148
Target Start/End: Original strand, 34579172 - 34579299
Alignment:
21 aacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcg 120  Q
    |||| ||||| ||||| | ||||||||| | |||  | ||||| || || || ||||| || || |||||||||||||| || ||   ||||||| ||||    
34579172 aacgatgaggcttcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgcttccttggtgccttaccaagggtggatctgcg 34579271  T
121 agctgtttgctttgtacgagccattgaa 148  Q
    ||| |||||||||||||| |||||||||    
34579272 agcagtttgctttgtacgcgccattgaa 34579299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 148
Target Start/End: Original strand, 34584921 - 34585048
Alignment:
21 aacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcg 120  Q
    |||| ||||| ||||| | ||||||||| | |||  | ||||| || || || ||||| || || |||||||||||||| || ||   ||||||| ||||    
34584921 aacgatgaggcttcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgcttccttggtgccttaccaagggtggatctgcg 34585020  T
121 agctgtttgctttgtacgagccattgaa 148  Q
    ||| |||||||||||||| |||||||||    
34585021 agcagtttgctttgtacgcgccattgaa 34585048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 145
Target Start/End: Complemental strand, 30884 - 30758
Alignment:
19 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 118  Q
    ||||||||| || ||||||||||| ||||| || ||||| |||||||| |||||||| || || || || || | ||| |||||||| ||||||||||||    
30884 gaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttg 30785  T
119 cgagctgtttgctttgtacgagccatt 145  Q
    || |||||||| || ||||| ||||||    
30784 cgtgctgtttgtttggtacgtgccatt 30758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 145
Target Start/End: Complemental strand, 21317446 - 21317320
Alignment:
19 gaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttg 118  Q
    ||||||||| || ||||||||||| ||||| || ||||| |||||||| |||||||| || || || || || | ||| |||||||| ||||||||||||    
21317446 gaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttg 21317347  T
119 cgagctgtttgctttgtacgagccatt 145  Q
    || |||||||| || ||||| ||||||    
21317346 cgtgctgtttgtttggtacgtgccatt 21317320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 68 - 146
Target Start/End: Original strand, 3930266 - 3930344
Alignment:
68 gcggcttttgttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgctttgtacgagccattg 146  Q
    |||||||| || || || || |||| ||| |||||||||||||||||||| || |||||||| || ||||| |||||||    
3930266 gcggctttggtggcgagttgtttccgtggggcttttcctccggtggattttcgtgctgtttgtttggtacgtgccattg 3930344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 83 - 144
Target Start/End: Original strand, 7594916 - 7594977
Alignment:
83 agctgcttccttggtgcttttcctccggtggatttgcgagctgtttgctttgtacgagccat 144  Q
    |||||||||||||| || || || ||||| || |||||||| |||||||| |||||||||||    
7594916 agctgcttccttggagccttaccaccggtagacttgcgagcggtttgcttggtacgagccat 7594977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University