View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3801_high_6 (Length: 516)
Name: NF3801_high_6
Description: NF3801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3801_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 317; Significance: 1e-178; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 317; E-Value: 1e-178
Query Start/End: Original strand, 15 - 343
Target Start/End: Original strand, 663628 - 663956
Alignment:
| Q |
15 |
gtgctccttttggaatagatgatccaaatgtgaatccattgggtccaatgtcacctaatttggctctacttggttgttctaaaatgcttgttactgttgc |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
663628 |
gtgctccttttgggatagatgatccaaatgtgaatccattgggtccaatgtcacctaatttggctttacttggttgttctaaaatgcttgttactgttgc |
663727 |
T |
 |
| Q |
115 |
tggtaaggatcgttttagggacagagctgttttgtattatgaagctgtgaaagggagtcattggaatggggaagttgaattttttgaagaagaagatgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
663728 |
tggtaaggatcgttttagggacagagctgttttgtattatgaagctgtgaaaaggagtcattggaatggggaagttgaattttttgaagaagaagatgaa |
663827 |
T |
 |
| Q |
215 |
gatcattgttattatatggtccatcctgaatctgataagggcaaaaaactcatcaaagttgtggctgattttcttcaccagtgaaagatttaagaaattg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
663828 |
gatcattgttattatatggtccatcctgaatctgataagggcaaaaaactcatcaaagttgtggctgattttcttcaccagtgaaagatttaagaaattg |
663927 |
T |
 |
| Q |
315 |
tatgggttgaataaggatatgtcatgcta |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
663928 |
tatgggttgaataaggatatgtcatgcta |
663956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 432 - 508
Target Start/End: Original strand, 664055 - 664131
Alignment:
| Q |
432 |
cacacatatagcaccttttactatgttgtttatgtcttacgtgtccttctactatgtcgtttttgtcttgcgtgtct |
508 |
Q |
| |
|
|||||||||||||||||||| ||||||| || |||||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
664055 |
cacacatatagcaccttttatcatgttgtctacgtcttacgtgtcattttactatgtcgtttttatcttgcgtgtct |
664131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 191 - 249
Target Start/End: Original strand, 47301902 - 47301960
Alignment:
| Q |
191 |
gaattttttgaagaagaagatgaagatcattgttattatatggtccatcctgaatctga |
249 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| |||| | |||||||||||||| |
|
|
| T |
47301902 |
gaattgtttgaagaagaagatgaagatcatgtttatcatatctttcatcctgaatctga |
47301960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University