View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3801_low_24 (Length: 310)
Name: NF3801_low_24
Description: NF3801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3801_low_24 |
 |  |
|
| [»] scaffold0031 (2 HSPs) |
 |  |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 122 - 297
Target Start/End: Complemental strand, 47649835 - 47649660
Alignment:
| Q |
122 |
taaatagatgaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgcttttgaatcagtt |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
47649835 |
taaatagacgaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtcattgcgaatattgcttttgaatcagtt |
47649736 |
T |
 |
| Q |
222 |
gtgggagagcgatcgggatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctgtcacaggtt |
297 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47649735 |
gtgggagggcgattgggatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctgtcacaggtt |
47649660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 4 - 126
Target Start/End: Complemental strand, 47650061 - 47649940
Alignment:
| Q |
4 |
atgtatttatattctgtgatgatgaaaatttgcttttagagagatcctgaaaccgaaaaggagcccaactatgaggatttatggagaatgactcacacaa |
103 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
47650061 |
atgtatttatattttgtgatgatgaaaatttgcttttagagagatcctgaaaccaaaaaggagcccaactataaggatttatggagaatgactcgcacaa |
47649962 |
T |
 |
| Q |
104 |
acagcaatggcgaatggataaat |
126 |
Q |
| |
|
|||||||||| | |||||||||| |
|
|
| T |
47649961 |
acagcaatggag-atggataaat |
47649940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 122 - 282
Target Start/End: Complemental strand, 91993 - 91833
Alignment:
| Q |
122 |
taaatagatgaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgcttttgaatcagtt |
221 |
Q |
| |
|
||||||||||| |||||||||| |||||||| | || || |||||||||||||| |||||||||||||| | ||| |||||||||||||| |||||||| |
|
|
| T |
91993 |
taaatagatgagggttgaagaagcttcttcatatcacctagaagctggatatgggaacactgataaagatttaattatgaatattgcttttaaatcagtt |
91894 |
T |
 |
| Q |
222 |
gtgggagagcgatcgggatattgtcgtggcttaggagctggaattaaacccctaaagggaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
91893 |
gtgggagagcgatcgggatattgtcgtggcttgggagctggaattaaaaccctaaagggaa |
91833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 92223 - 92098
Alignment:
| Q |
1 |
tatatgtatttatattctgtgatgatgaaaatttgcttttagagagatcctgaaaccgaaaaggagcccaactatgaggatttatggagaatgactcaca |
100 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||| |||||| |||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
92223 |
tatatgtatttatattttgtgacgatgaaaatttgcttttagagagatcttgaaactgaaaaggagcacaactataaggatttatggagaatgactcaca |
92124 |
T |
 |
| Q |
101 |
caaacagcaatggcgaatggataaat |
126 |
Q |
| |
|
||||| ||| || |||||||||||| |
|
|
| T |
92123 |
taaacaacaacggagaatggataaat |
92098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 170759 - 170884
Alignment:
| Q |
1 |
tatatgtatttatattctgtgatgatgaaaatttgcttttagagagatcctgaaaccgaaaaggagcccaactatgaggatttatggagaatgactcaca |
100 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||| |||||| |||||||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
170759 |
tatatgtatttatattttgcaatgatgaaaatttgcttttagagagatcccgaaaccaaaaaggaggctaactataaggatttatggagaatgactcaca |
170858 |
T |
 |
| Q |
101 |
caaacagcaatggcgaatggataaat |
126 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
170859 |
caaacagcaatggagaatggataaat |
170884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 129 - 185
Target Start/End: Original strand, 170993 - 171049
Alignment:
| Q |
129 |
atgaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
170993 |
atgaaggttgaagaaacttcttcagttttcttacaagctggatatgaggacactgat |
171049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 30753951 - 30753873
Alignment:
| Q |
134 |
ggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtgattgtgaatattgctttt |
212 |
Q |
| |
|
|||||||||| ||||||| | ||||| | || || ||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
30753951 |
ggttgaagaagcttcttctgattactcagaaactagatatggggacaccgataaagatgtgattacgaatattgctttt |
30753873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 30754199 - 30754130
Alignment:
| Q |
1 |
tatatgtatttatattctgtgatgatgaaaatttgcttttaga--gagatcctgaaaccgaaaaggagcc |
68 |
Q |
| |
|
||||| || ||||||| ||||||||||||||| |||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
30754199 |
tatatctaattatattttgtgatgatgaaaatatgcttttagagagagatcgtgaaactgaaaaggagcc |
30754130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University