View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3801_low_25 (Length: 295)

Name: NF3801_low_25
Description: NF3801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3801_low_25
NF3801_low_25
[»] chr1 (1 HSPs)
chr1 (18-81)||(6946160-6946223)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 6946160 - 6946223
Alignment:
18 gttaattgcattgttgagtcgtcttggttgtatctcaatatccttgtcatgttggctgcgaaat 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
6946160 gttaattgcattgttgagtcgtcttggttgtatctcaatatccttatcatgttggctgcgaaat 6946223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University