View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3801_low_37 (Length: 223)
Name: NF3801_low_37
Description: NF3801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3801_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 2 - 178
Target Start/End: Complemental strand, 24860152 - 24859976
Alignment:
| Q |
2 |
ttttggttttgttgagatttgattgattgtggagtgagtgtggccgttgataagaagctaatcaacggttgtggtggttagttgagtgatggcacggatc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24860152 |
ttttggttttgttgagatttgattgattgtggagtgaatgtggccgttgataagaagctaatcaacggttgtagtggttagttgagtgatggcacggatc |
24860053 |
T |
 |
| Q |
102 |
gtgatccgtgtgactgtgaaagaaccaatagctggataagtgtaaatgaggagataagattttttaaacaggagatg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24860052 |
gtgatccgtgtgactgtgaaagaaccaatagctggataagtgtaaatggggagataagattttttaaacaggagatg |
24859976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University