View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3801_low_40 (Length: 216)
Name: NF3801_low_40
Description: NF3801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3801_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 44061353 - 44061536
Alignment:
| Q |
19 |
attttaacagcaaaatcctcactcacctaagtaacatccaatttcacttctaagatattaatttatttt-cactttcaaaaacaatgaaaatgaagtgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44061353 |
attttaacagcaaaatcctcactcacctaagtaacaaccaatttcacttctaagatattaatttatttttcactttcaaaaacaatgaaaatgaagtgag |
44061452 |
T |
 |
| Q |
118 |
ttagtaaatgctaacctgaacaaaatcagtcccaaaaattggttcaccattgtcatcaagaacacggtaacaaggaactctgtg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44061453 |
ttagtaaatgctaacctgaacaaaatcagtcccaaaaattggttcaccattatcatcaagaacacggtaacaaggaactctgtg |
44061536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University