View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3802_low_5 (Length: 281)
Name: NF3802_low_5
Description: NF3802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3802_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 264
Target Start/End: Complemental strand, 5262696 - 5262447
Alignment:
| Q |
13 |
caaaggagtgcagcatcaccttattttttatatttgaaagggcttgaaaaatatgatgttttggagaaagnnnnnnnnccttcaagaatcacacaatttt |
112 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5262696 |
caaaggagtgcgacctcaccttattttttatatttgaaagggcttgaaaaatatgatgttttggagaaa--aaaaaacccttcaagaatcacacaatttt |
5262599 |
T |
 |
| Q |
113 |
gattttggatggtgaaagaataatttttgtgaagtaacctaactatgaaaacgaaggagcttctcaattagacttatttacaagaaggtttcagattata |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5262598 |
gattttggatggtgaaagaacaatttttgtgaagtaacctaactatgaaaacgaaggagtttctcggttagacttatttacaagaaggtttcagattata |
5262499 |
T |
 |
| Q |
213 |
tagtctaaaaatctttaaataaaagtttaaattatataatctgaaggagagt |
264 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5262498 |
tagtctaaaagtctttaaataaaagtttaaattatataatcagaaggagagt |
5262447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University