View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3803_high_10 (Length: 338)
Name: NF3803_high_10
Description: NF3803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3803_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 17 - 332
Target Start/End: Complemental strand, 14200485 - 14200171
Alignment:
| Q |
17 |
aggatatatttgtgatgtaaaatggttgagaaggattgaggttttagtttgtgatccttgttaatgaatttgtctcctatttcgtttttgcctccatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14200485 |
aggatatatttgtgatgtaaaatggttgagaaggattgaggttttagtttgtgatccttgttaatgaatttgtctcctatttcgtttttgcctccatttt |
14200386 |
T |
 |
| Q |
117 |
tgtagtgatggtgagtttgttcgtccttttctattttctgtcatcttagtggattttatttatttatggggatgggtttagcttcatggccaaaaaatcc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14200385 |
tgtagtgatggtgagtttgttcgtccttttctattttctgtcatcttagtggatttt-tttatttatggggatgggtttagcttcatggccaaaaaatcc |
14200287 |
T |
 |
| Q |
217 |
ttgatacatacatatttttcattatggacatgttcgtcttcttgtgctttggctatggtctatattctcactcttatcctcttccccttcaatcacggtt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14200286 |
ttgatacatacatatttttcattatggacatgttcgtcttcttgtgctttggctatggtctatattctcactcttatcctcttccccttcaatcacggtt |
14200187 |
T |
 |
| Q |
317 |
gcaattttccacctat |
332 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
14200186 |
gcaattttccccctat |
14200171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University