View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3803_high_21 (Length: 240)
Name: NF3803_high_21
Description: NF3803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3803_high_21 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44949388 - 44949168
Alignment:
| Q |
1 |
caacactgaagtcacaggaaaacaaatagaggagattttgcaaactttggttttagatgatgagatcatgcagatgacaagtgctggatatggggatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949388 |
caacactgaagtcacaggaaaacaaatagaggagattttgcaaactttggttttagatgatgagatcatgcagatgacaagtgctggatatggggatttt |
44949289 |
T |
|
| Q |
101 |
gcatttattccagttggcaaaacttgttacatatgcaaaagcaagggtggagttataggggaaaagaaatctggctactttacttcctttccatgttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949288 |
gcatttattccagttggcaaaacttgttacatatgcaaaagcaagggtggagttataggggaaaagaaatctggctactttacttcctttccatgttttt |
44949189 |
T |
|
| Q |
201 |
cttgtgagcgaatgagctttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44949188 |
cttgtgagcgaatgagctttt |
44949168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 6470229 - 6470089
Alignment:
| Q |
9 |
aagtcacaggaaaacaaatagaggagattttgcaaactttggttttagatgatgagatcatgcagatgacaagtgctggatatggggattttgcatttat |
108 |
Q |
| |
|
||||||| ||| |||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
6470229 |
aagtcacgggagaacaaatagaagagattttacaaactttggttttagatgatgagataatgcagatgacaagtactggatatggggattttgcatctat |
6470130 |
T |
|
| Q |
109 |
tccagttggcaaaacttgttacatatgcaaaagcaagggtg |
149 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6470129 |
tcctgttggcaaaacttgttacatatgcaaaagcaagggtg |
6470089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 6 - 67
Target Start/End: Complemental strand, 44943594 - 44943533
Alignment:
| Q |
6 |
ctgaagtcacaggaaaacaaatagaggagattttgcaaactttggttttagatgatgagatc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44943594 |
ctgaagtcacaggaaaacaaatagaggagattttgcaaactttggttttagatgatgagatc |
44943533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 9 - 149
Target Start/End: Original strand, 419455 - 419595
Alignment:
| Q |
9 |
aagtcacaggaaaacaaatagaggagattttgcaaactttggttttagatgatgagatcatgcagatgacaagtgctggatatggggattttgcatttat |
108 |
Q |
| |
|
||||||| ||| | |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
419455 |
aagtcacgggagaccaaatagaagagattttgcaaactttggttttagacgatgagatcatgcagatgacaagtactggatatggggattttgcatctat |
419554 |
T |
|
| Q |
109 |
tccagttggcaaaacttgttacatatgcaaaagcaagggtg |
149 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
419555 |
tcccgttggcaaaacttgttacatatgcaaaagcaagggtg |
419595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University